We narrowed to 9,366 results for: tre promoter
-
Plasmid#85530PurposeInducible expression of guide RNA (huMcl-1.1) with fluorescent GFP reporterDepositorAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA-DDX11-Flag-KAE
Plasmid#120728PurposeExpression of a Flag-tagged version of DDX11 KAE mutant in mammalian cellsDepositorInsertDDX11 KAE mutant (DDX11 Human)
Tags3x FLAGExpressionMammalianMutationSubstitution of E201 and Y202 with K and APromoterCMVAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-DDX11-Flag-KAK
Plasmid#120729PurposeExpression of a Flag-tagged version of DDX11 KAK mutant in mammalian cellsDepositorInsertDDX11 KAK mutant (DDX11 Human)
Tags3x FLAGExpressionMammalianMutationSubstitution of E201, Y202 and E203 with K, A and…PromoterCMVAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-VCF1 N167A
Plasmid#223019PurposeExpression of GFP-tagged VCF1 (p97 binding-deficient N167A mutant) in mammalian cells.DepositorAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMDC43-FIT2-FLL[157-159]AAA
Plasmid#96994PurposeExpress GFP-tagged mutated mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
TagsGFPExpressionPlantMutationAmino acid residues 157-159 were mutated (FLL[157…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMDC32-FIT2-FLL[157-159]AAA
Plasmid#96991PurposeExpress mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
ExpressionPlantMutationAmino acid residues 157-159 were mutated (FLL[157…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDLxR6
Plasmid#172560PurposeInducible gene expression, pCDF origin, LuxR activator, PLuxB promoter, mRFP, Streptomycin Resistance Marker.DepositorInsertLuxR-mRFP
UseSynthetic BiologyExpressionBacterialPromoterPLuxBAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCLxR6
Plasmid#172557PurposeInducible gene expression, pCOLA origin, LuxR activator, PLuxB promoter, mRFP, Streptomycin Resistance Marker.DepositorInsertLuxR-mRFP
UseSynthetic BiologyExpressionBacterialPromoterPLuxBAvailable SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDCyR6
Plasmid#172558PurposeInducible gene expression, pCDF origin, CymRAM repressor, PCymRC promoter, mRFP, Streptomycin Resistance Marker.DepositorInsertCymRAM-mRFP
UseSynthetic BiologyExpressionBacterialPromoterPCymRCAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-SUMO-mGSDMD
Plasmid#111560PurposeExpress mouse GSDMD in E.coliDepositorAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mGSDMD1-251
Plasmid#111565PurposeExpress ELANE-cleaved mouse GSDMD in mammalian cellsDepositorAvailable SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQCXIX-Myc-hTIM3
Plasmid#110893PurposeExpression of Myc-tagged hTIM3 at the cell surfaceDepositorInsertHepatitis A virus Cellular Receptor 2 (HAVCR2) (HAVCR2 Human)
UseRetroviralTagsMycPromoterCMVAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR-SNAP-PDL1
Plasmid#223602PurposeLentiviral expression of human PD-L1 with SNAP tag in mammalian cellsDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-PDL1-LgBiT
Plasmid#223619PurposeLentiviral expression of human PD-L1 with LgBiT tag in mammalian cellsDepositorAvailable SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
FLAG-β-arrestin2 RRK/Q-5-kinase domain fusion protein (RRK5K)
Plasmid#38262DepositorInsertβ-arrestin2 (Arrb2 Rat)
TagsFlag and PIP5K Iα core kinase domain (residues 18…ExpressionMammalianMutationArg 233, Arg237, and Lys251 converted to Glutamin…PromoterCMVAvailable SinceAug. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-C-eGFP-Ctdnep1_D67EsiR
Plasmid#196518PurposeExpression of Ctdnep1_D67E-GFPDepositorInsertCtdnep1_D67EsiR (CTDNEP1 Human)
TagseGFPExpressionMammalianMutationD67E mutation (phosphastase dead). Silent mutatio…PromoterCMV promoter; T7 promoterAvailable SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLIX-hN1ICD
Plasmid#91897PurposeDoxycycline inducible expression of human Notch1 ICDDepositorInsertNotch1 intracellular domain (NOTCH1 Human)
UseLentiviralExpressionMammalianMutationcodons 1770 to 2555 of human NOTCH1PromoterTRE promoter, Tet ONAvailable SinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits only