We narrowed to 3,353 results for: guide rna expression plasmid
-
Plasmid#238041PurposeEncodes sfGFP under lac promoter. Expresses a single guide RNA (under Rha promoter), which targets a noncoding region of the plasmid as part of the ADEPT system. Carries oriT and kan resistance.DepositorInsertsfGFP
UseSynthetic BiologyPromoterlacAvailable SinceJune 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget-RFP
Plasmid#238040PurposeEncodes mRFP1 under pLux promoter. Expresses a single guide RNA (under Ara promoter), which targets a noncoding region of the plasmid as part of the ADEPT system. Carries oriT and kan resistance.DepositorInsertmRFP1
UseSynthetic BiologyPromoterLuxAvailable SinceJune 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
ADEPT-pTarget
Plasmid#238033PurposeEncodes sfGFP-SsrA under constitutive promoter (J23119). Expresses a single guide RNA, which targets a noncoding region of the plasmid as part of the ADEPT system. Carries oriT and kan resistance.DepositorInsertsfGFP
UseSynthetic BiologyTagsssrAPromoterJ23119 (constitutive)Available SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIA33
Plasmid#120803PurposeE. coli-C. difficile shuttle vector for CRISPR interference (CRISPRi) in C. difficile; sgRNA targets rfp; Pxyl::dCas9-opt Pgdh::sgRNA-rfpDepositorInsertsdeactivated nuclease dCas9, codon-optimized for C. difficile
single guide RNA targeting red fluorescent protein
UseCRISPRExpressionBacterialMutationBase-pairing region targets red fluorescent prote…PromoterPgdh and PxylAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEP-GluA2 TKIT
Plasmid#169442PurposeExpression of 2 guides + donor DNADepositorInsertSuper ecliptic pHluorin (SEP)
UseAAV and CRISPRAvailable SinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEP-GluA1 TKIT
Plasmid#169441PurposeExpression of 2 guides + donor DNADepositorInsertSuper ecliptic pHluorin (SEP)
UseAAV and CRISPRAvailable SinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
DR274
Plasmid#42250Purposeguide RNA (gRNA) expression vector used to create a gRNA to a specific sequence; uses T7 promoter for in vitro transcriptionDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR; Zebrafish expressionExpressionWormPromoterT7Available SinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLC133
Plasmid#198639PurposeExpression plasmid for dCas9 in E. coli used in Chip-seq experiments. dCas9 is tagged with a C-terminal 3x FLAG tag. A guide RNA can be cloned using BsaI restriction sites.DepositorInsertdCas9
Tags3x-FLAGExpressionBacterialPromoterpTetAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-24xMS2
Plasmid#212629PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-24xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-2xMS2
Plasmid#212627PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-2xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-12xMS2
Plasmid#212628PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-12xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Puro-4xMS2
Plasmid#212626PurposeMS2 hairpin-containing expression vector and sgRNA entry plasmid for the directed export of barcode transcripts in Gag-MCP virus-like particlesDepositorInsertEF1a-PuroR-4xMS2-WPRE-hU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE4-RrA3F
Plasmid#138340PurposeMammalian expression plasmid for BE4-RrA3FDepositorInsertBE4-RrA3F
TagsBP-NLSExpressionMammalianPromoterCMVAvailable SinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE4-PpAPOBEC1
Plasmid#138349PurposeMammalian expression plasmid for BE4-PpABOBEC1DepositorInsertBE4-PpAPOBEC1
TagsBP-NLSExpressionMammalianPromoterCMVAvailable SinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd (no NLS) g4+g10+g18 (FWA)
Plasmid#117168PurposeCRISPR Cas9 SunTag system to target NtDRMcd (without an NLS) to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_NOS_NLS_GB1_noNLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gLacZ.hSyn.flex.H2B.RFP
Plasmid#170373PurposeNegative control guide, Cre-inducible plasmid expressing nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE4-SsAPOBEC3B
Plasmid#138343PurposeMammalian expression plasmid for BE4-SsAPOBEC3BDepositorInsertBE4-SsAPOBEC3B
UseSynthetic BiologyTagsBP-NLSPromoterCMVAvailable SinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE4-AmAPOBEC1
Plasmid#138342PurposeMammalian expression plasmid for BE4-AmABOBEC1DepositorInsertBE4-AmAPOBEC1
UseSynthetic BiologyTagsBP-NLSPromoterCMVAvailable SinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only