We narrowed to 11,444 results for: nar
-
Plasmid#68832PurposeExpresses c-myc-tagged human RAD18 deleting hRAD6 binding domainDepositorInsertc-myc tagged human RAD18 deleting hRAD6 binding domain (RAD18 Human)
Tagsc-mycExpressionMammalianPromoterCAGAvailable SinceOct. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC19-G2ZYP2
Plasmid#103110PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertG2ZYP2(Cas9 coding gene from Ralstonia syzygii R24)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
LG002: pMAGIC (L1-R5) mU6::xCas9(3.7) gRNA scaffold
Plasmid#121816PurposepMAGIC L1-R5 entry plasmid, contains empty mouse U6-driven xCas9(3.7) (i.e. SpCas9) gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRD408
Plasmid#178199PurposeExpression of H-NS from its natural promoterDepositorAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1 ObLiGaRe Donor vector/EPB58
Plasmid#90016PurposeDonor vector for ObLiGaRe/ZFN mediated targeting to AAVS1 locusDepositorInsertMCS flanked by inverted ZFN binding sites (PPP1R12C Human)
ExpressionBacterialAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
myc-hRAD18 C207F
Plasmid#68829PurposeExpresses c-myc-tagged human RAD18 with C207F mutationDepositorInsertc-myc tagged human RAD18 with C207F mutation (RAD18 Human)
Tagsc-mycExpressionMammalianPromoterCAGAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCAG-F-API5
Plasmid#157662PurposeExpresses API5 in mammalian cellDepositorAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C2_3X Flag
Plasmid#194161PurposeExpresses eGFP fluorescent protein with a 3X flag tagDepositorInsertGFP with 3X Flag
Tags3x FlagExpressionMammalianAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cas9_YTHDF2_sgRNA
Plasmid#186673PurposeYTHDF2 sgRNA plasmidDepositorInsertYTHDF2 KO sgRNA Plasmid (YTHDF2 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRD190
Plasmid#163100PurposeExpression of mEos3.2 in eukaryotes to stain the nuclear compartmentDepositorInsertNLS_mEos3.2_NLS
UseEukaryotic expressionExpressionMammalianPromoterCMV promoter; T7 promoterAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTE4565
Plasmid#88903PurposeExpresses inactive/dead, humanized MbCpf1 nucleaseDepositorInserthMbCpf1(D986A)
UseCRISPRTags3xHA and NLSExpressionMammalianPromoterCMVAvailable SinceApril 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28b-API5
Plasmid#157655PurposeExpresses API5 in E.coli cellDepositorAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmiR-96 cluster promoter
Plasmid#62517PurposemicroRNA 183-96-182 cluster promoter luciferase plasmidDepositorInsertpromoter of microRNA-183-96-182 cluster
TagsRenSP (optimized renilla luciferase gene)ExpressionMammalianAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
IR904: pMVP (L3-L2) pA; CMV::eGFP-P2A-TETa-pA
Plasmid#121799PurposepMVP L3-L2 entry plasmid, contains polyA + CMV-eGFP-P2A-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds CMV-driven GFP-P2A-TETa downstream of gene of interest.DepositorInsertpolyA + CMV::eGFP-P2A-TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-B2UP49_GFP
Plasmid#103071PurposeCas9 coding gene template with optimized sequence for human codon usage, also expresses EGFPDepositorInsertB2UP49(Cas9 coding gene from Akkermansia muciniphila (strain ATCC BAA-835))
UseCRISPRExpressionMammalianMutationhuman codon-optimizedPromoterCMVAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-A0LWB3
Plasmid#103070PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertA0LWB3(Cas9 coding gene from Acidothermus cellulolyticus (strain ATCC 43068 / 11B))
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
KB501: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold; CMV promoter
Plasmid#121813PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and CMV promoter for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTE4567
Plasmid#107557PurposeExpresses human codon optimized inactive MbCpf1(dead2) in mammalian cells.DepositorInserthMbCpf1(dead2)
Tags3xHA and NLSExpressionMammalianMutationE1080APromoterCMVAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
KN801: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS-VPR
Plasmid#121829PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) fused to the VPR transcriptional activator for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7)/VPR (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only