We narrowed to 5,897 results for: dna plasmids
-
Plasmid#216080PurposeITRs from AAV2, destination vectorDepositorHas ServiceCloning Grade DNAInsertITRs from AAV2
UseAAV; DestinationExpressionMammalianAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC-POLQ-DM
Plasmid#64880Purposelentiviral expression of human POLQ double mutant (in POL and HDL domains)DepositorInsertPOLQ (POLQ Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationK121M and D2330A,Y2331APromoterEF1alphaAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKD068
Plasmid#136471PurposeSSB-GFP IDL fusion expression plasmidDepositorInsertSSB-GFP (ssb E. coli)
Tagssuperfolder GFPExpressionBacterialMutationsuperfolder GFP inserted between Phe148 and Ser149PromoterT7 promoterAvailable SinceApril 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
SECURE miniABEmax-V82G (pJUL1828)
Plasmid#131313PurposeCMV promoter expression plasmid for bpNLS-TadA7.10(V82G)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS (miniABEmax with V82G mutation).DepositorInsertbpNLS-TadA7.10(V82G)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS
ExpressionMammalianPromoterCMVAvailable SinceSept. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
SuExp His-Myc-mPLD4
Plasmid#201185PurposeProtein expression plasmid for recombinant His-Myc tag mouse PLD4DepositorTagsHis-Myc, Factor Xa cleavableExpressionMammalianMutationcytosolic and transmembrane domain truncated; add…PromoterCMVAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKD072
Plasmid#136472PurposeSSB-C-term-GFP fusion expression plasmidDepositorInsertSSB-C-term-GFP (ssb E. coli)
Tagssuperfolder GFPExpressionBacterialMutationsuperfolder GFP attached to C-terminus at Phe 178PromoterT7 promoterAvailable SinceApril 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6.gDNMT1.Cas9-T2A-GFP
Plasmid#170362PurposePlasmid used for Crispr/cas9 based disruption of human DNMT1.DepositorInsertCas9-T2A-GFP
UseLentiviralAvailable SinceJune 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSCL.175
Plasmid#184996PurposeExpress -Eco1 HEK3 editing ncRNA and gRNADepositorInsertEco1: HEK3 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationHEK3 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.177
Plasmid#184998PurposeExpress -Eco1 EMX1 editing ncRNA and gRNADepositorInsertEco1: EMX1 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationEMX1 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
QSOX1-luciferase
Plasmid#113352Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of QSOX1 geneDepositorInsertQSOX1-enhancer (QSOX1 Human)
UseLuciferaseAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
ATP9A-luciferase
Plasmid#113354Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of ATP9A geneDepositorInsertATP9A-enhancer (ATP9A Human)
UseLuciferaseAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSCL.180
Plasmid#185001PurposeExpress -Eco1 AAVS1 editing ncRNA and gRNADepositorInsertEco1: AAVS1 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationAAVS1 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK2-miR-34 MT
Plasmid#78259PurposepsiCHECK2 dual luciferase reporter harboring a mutated miR-34 target element, cloned into the XhoI/NotI restriction sites, the 3'UTR of the Renilla Luciferase geneDepositorInsertmutated miR-34 target site
UseLuciferase; Microrna activityExpressionMammalianMutationnucleotides 2-5 and 10-11 changed from CCGT to GG…Available SinceJune 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTE4254
Plasmid#89050PurposeExpresses St chimeric gRNA and human codon-optimized StCas9DepositorInsertsSt chimeric gRNA
hStCas9
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterCMV and human U6Available SinceApril 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC-POLQ-S1977P
Plasmid#64876Purposelentiviral expression of human POLQ S1977P mutant (mimicks the chaos1 mutation)DepositorInsertPOLQ (POLQ Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationS1977P, mimicking the chaos1 mutationPromoterEF1alphaAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
SunTagCACTA1g2-22aa-TET1cd
Plasmid#106437PurposeSunTag CRISPR cas9 system that targets the TET1 catalytic domain to the CACTA1 promoterDepositorInsertCACTA1gRNA2_U6_NOS_TET1CD_2xNLS_1xHA__sfGFP_scFv_UBQ10_INSULATOR_UBQ10_dCAS9_1xHA_3xNLS_10xGCN422aa_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_KMT2B
Plasmid#101070PurposeDonor vector for 3' FLAG tag of human KMT2BDepositorAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKS7107
Plasmid#89051PurposeExpresses Nm crRNA, Nm tracrRNA and human codon-optimized NmCas9DepositorInsertsNm crRNA
Nm tracrRNA
hNmCas9
UseCRISPRTagsHA tag, NLS, and SV40 NLSPromoterEF1a and human U6Available SinceApril 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZJQIBEBT003
Plasmid#140053PurposeThe pZJQIBEBT003 plasmid contains the coding sequence of eMutS-L157C-G233C gene which has the ability of error removal in the gene synthesis process.DepositorInserteMutS-L157C-G233C-CBM-EGFP
TagsHis-TagExpressionBacterialMutationL157C, G233CPromoterT7Available SinceJune 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only