We narrowed to 13,228 results for: sequence
-
Plasmid#55797PurposeThis highly effective dominant negative G protein alpha-s mutant contains, in addition to the mutations in alpha-s(alpha3beta5/G226A), the A366S mutation, which increases GDP release.DepositorInsertalpha-s (alpha3beta5/G226A/A366S) (Gnas Rat)
Tagsinternal EE epitope (residues 189-194 in alpha-s …ExpressionMammalianMutationN271K, K274D, R280K, T284D, I285T, G226A, A366S i…PromoterCMVAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
ITGB3
Plasmid#51921PurposeExpresses full-length Integrin beta-3 precursor ectodomain in mammalian cells. Stop codon before C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertITGB3 (ITGB3 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianMutationStop Codon at amino acid 718, before CD4, bio and…PromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
GST scFv [N100/13]
Plasmid#190521PurposeMammalian Expression of GST scFV. Derived from hybridoma N100/13.DepositorInsertGST (Schistosoma japonicum) recombinant scFV
TagsHA, Sortase, 6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
TrpC5 scFv [N67/15]
Plasmid#190564PurposeMammalian Expression of TrpC5 scFV. Derived from hybridoma N67/15.DepositorInsertTrpC5 (Homo sapiens) recombinant scFV (TRPC5 Mouse)
TagsHA, Sortase, 6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-q-YFP
Plasmid#55782PurposeThis G protein alpha-q construct contains internal insertions of YFP and the EE epitope.DepositorInsertalpha-q EE YFP (Gnaq Mouse)
TagsThe EE epitope was introduced into the alpha-q se…ExpressionMammalianMutationBamHI and SacI sites in alpha-q were removed with…PromoterCMVAvailable SinceAug. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
VGlut2 scFv [N29/29]
Plasmid#182085PurposeMammalian Expression of VGlut2 scFv. Derived from hybridoma N29/29.DepositorInsertrecombinant mouse scFv targeting VGlut2 (Rattus norvegicus) (Slc17a6 Mouse)
TagsHA, HisExpressionMammalianPromoterCMVAvailable SinceMarch 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-GFP [N86/34R]
Plasmid#220419PurposeMammalian Expression Plasmid of anti-GFP (Jellyfish) IgG2a R-mAb. Derived from hybridoma N86/34DepositorInsertAnti-GFP (Aequorea victoria) recombinant mouse monoclonal antibody.
ExpressionMammalianPromoterDual CMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
RANLS-DEVD-BNES
Plasmid#50840PurposeExpresses a tandem ddFP heterodimer in mammalian cells, plasmid 1 for a translocation-based red fluorescent caspase-3 biosensor, used together with plasmid 2 (BNLS).DepositorInsertddRFP A and ddRFP B
TagsNES sequence LALKLAGLDIGS and triplicated NLS seq…ExpressionMammalianPromoterCMVAvailable SinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
Parvalbumin scFv [L114/3]
Plasmid#190504PurposeMammalian Expression of Parvalbumin scFV. Derived from hybridoma L114/3.DepositorInsertParvalbumin (Rattus norvegicus) recombinant scFV (Pvalb Mouse)
TagsHA, 6xHis, FlagExpressionMammalianPromoterCMVAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
GANES-DEVD-BNLS
Plasmid#50842PurposeExpresses a tandem green ddFP heterodimer in mammalian cells, construct 1 for a green to red colour switch-based fluorescent caspase-3 biosensor, used together with a second plasmid RANLS.DepositorInsertddGFP A and ddGFP B
TagsNES sequence LALKLAGLDIGS placed after ddGFP A an…ExpressionMammalianPromoterCMVAvailable SinceJan. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
SPHKAP scFv [L131/17]
Plasmid#190511PurposeMammalian Expression of SPHKAP scFV. Derived from hybridoma L131/17.DepositorInsertSPHKAP (Mus musculus) recombinant scFV (Sphkap Mouse)
TagsHA, Sortase, 6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i4-ipUSEPR-TR657
Plasmid#228930PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i4 (Trp53 sequence: GTCGCTACCTACAGCCAGGA, Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA.3.1.ADRB2-NP
Plasmid#134376PurposeNanoluc complementation assay. Expression of adrenoceptor beta 2 fused at C termimus with Natural peptide (NP) of NanoLuc. Addition of signal sequence and Flag epitope at N terminus of ADRB2.DepositorInsertADRB2-NP (ADRB2 Human)
TagsFlag, natural peptide of nanoluciferase, and sign…ExpressionBacterial and MammalianPromoterT7Available SinceAug. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB-mCherry-DMDEx23-eGFP
Plasmid#211366PurposePiggybac transposon plasmid for a DMD exon 23 skipping reporter (mCherry-DMDEx23)DepositorInsertmCherry-DMDEx23-eGFP
ExpressionMammalianMutationmCherry interrupted by mdx dystrophin exon 23 bet…PromoterCAGAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pan-Synapsin scFv [L125/129]
Plasmid#182079PurposeMammalian Expression of pan-Synapsin scFv. Derived from hybridoma L125/129.DepositorInsertrecombinant mouse scFv targeting pan-Synapsin
TagsSortase, HisExpressionMammalianPromoterCMVAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
IL6ST-bio-His
Plasmid#51806PurposeExpresses full-length Interleukin-6 receptor subunit beta precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertIL6ST (IL6R Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
NESRA-DEVD-BNLS
Plasmid#50849PurposeExpresses a tandem red ddFP heterodimer in mammalian cells, construct 1 for a red to green colour switch-based fluorescent caspase-3 biosensor, used together with a second plasmid GANLS.DepositorInsertddRFP A and ddRFP B
TagsNES sequence LQKKLEELELDE placed after ddGFP A an…ExpressionMammalianPromoterCMVAvailable SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
Pan-QKI scFv [N147/6]
Plasmid#211605PurposeMammalian Expression Plasmid of Pan-QKI scFv. Derived from hybridoma N147/6.DepositorAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a-KRAB_crRNA NC
Plasmid#176262PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged to the KRAB domain and Nlux and spacer sequence is replaced by the type IIS restriction site for endonucleasDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsKruppel associated box domain and luciferaseMutationD917A and E1006A mutations to inactivate the endo…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1‐hsRNASEH2BCA(D34A/D169A)
Plasmid#108693PurposeFor expression in E coli of N-terminally GST-tagged human RNASEH2B and untagged RNASEH2C and A (with D34A and D169A catalytic site mutations) for purification of the RNase H2 trimeric enzymeDepositorTagsGSTExpressionBacterialMutationShine Dalgarno sequence upstream of start codon, …PromotertacAvailable SinceApril 23, 2018AvailabilityAcademic Institutions and Nonprofits only