We narrowed to 6,012 results for: ATC
-
Plasmid#192344PurposeLentiviral expression vector for an inducible shNUP37 v2DepositorInsertshNUP37 v2 (NUP37 Human)
UseLentiviralAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMpGE010-Target1 (Mpphot)
Plasmid#186728PurposeBinary vector for CRISPR/Cas9 (target 1: Mpphot [positive control]) in plants (for Agrobacterium-mediated genetic transformation).DepositorInsertMphot
ExpressionBacterialAvailable SinceMarch 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pORE303N_CEN1
Plasmid#194439PurposeCRISPR, Cas9 driven by double 35S, nptII for plant selection, knockout CEN1DepositorInsertgRNA targeting CEN1
UseCRISPRExpressionPlantPromoterMtU6Available SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR3_BC2
Plasmid#191857PurposeBarcoded plasmid with BsaI sites to clone sgRNA. The 6-nucleotide barcode (sequence: ATCATG) near the sgRNA insert region enables demultiplexing replicates while sequencing the sgRNA region.DepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMV:AsCpf1-2A-GFP-U6-INS-sg
Plasmid#194719PurposeBicistronic vector expressing CMV promoter driven AsCpf1, and U6 promoter driven guide RNA that target hINSDepositorArticleAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgPIGA guide 2
Plasmid#193611PurposePIGA knockoutDepositorInsertsgPIGA guide 2 (PIGA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgNFkBIA guide 1
Plasmid#193595PurposeNFkBIA knockoutDepositorInsertsgNFkBIA guide 1 (NFKBIA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgNFkBIA guide 2
Plasmid#193596PurposeNFkBIA knockoutDepositorInsertsgNFkBIA guide 2 (NFKBIA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgSNRPA guide 2
Plasmid#193599PurposeSNRPA knockoutDepositorInsertsgSNRPA guide 2 (SNRPA Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003_sgTFAP4 guide 1
Plasmid#193586PurposeTFAP4 knockoutDepositorInsertsgTFAP4 guide 1 (TFAP4 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003_sgTFAP4 guide 2
Plasmid#193587PurposeTFAP4 knockoutDepositorInsertsgTFAP4 guide 2 (TFAP4 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330A-T#1
Plasmid#171515Purposedeletion of a genomic locus in T(Brachyury) geneDepositorAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
EK0425 CMV-TO-BFPmut-stop-Bdnf.t+54@202 (FLP-IN)
Plasmid#191147PurposeExpression of the sequence matching the 54 extra bases in EK0362 in mammalian cellsDepositorInsertBdfn.t+54
ExpressionMammalianMutationWTPromoterCMV-TOAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR_HLA_DRB
Plasmid#164992PurposeExpression of gRNA targeting HLA-DRB locus, including DRB1*01:02:01DepositorInsertgRNA against HLA-DRB1*01:02:01
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9341 (pgRNA_IX-1_NatMX)
Plasmid#161593PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site IX-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_MTOR
Plasmid#183311PurposeAll-in-One CRISPRko system with a guide RNA that targets MTOR geneDepositorInsertMTOR
UseLentiviralAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
shRNA-Ratio-PosCon
Plasmid#183553PurposeDesigned to test the efficacy of shRNA by assessing the ratio of GFP-fusion protein to RFP (shRNA ratio positive control (Pbrm1), Figure S2)DepositorInsertPbrm1 shRNA
ExpressionMammalianPromoterCBhAvailable SinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_CYP19A1
Plasmid#183280PurposeAll-in-One CRISPRko system with a guide RNA that targets CYP19A1 geneDepositorInsertCYP19A1
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_FLT1
Plasmid#183292PurposeAll-in-One CRISPRko system with a guide RNA that targets FLT1 geneDepositorInsertFLT1
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only