We narrowed to 867 results for: gfp control plasmid
-
Plasmid#127520PurposePlasmid has an inverted CaMV 35S promoter sequence (reverse complement) flanked by attB and attP attachment sites of integrases 2, 4, and 5. EGFP coding sequence is in the forward orientation.DepositorInsertCaMV 35S reverse complement promoter sequence flanked by attB/attP Integrase 2, 4 and 5 attachment sites.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)Bxb1
Plasmid#127511PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase Bxb1 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase Bxb1 attachment sites.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-pEF-GFP(rc)phiC31
Plasmid#127510PurposePlasmid has an EF1 alpha promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase phiC31 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase phiC31 attachment sites.
ExpressionMammalianAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-2xMARS-nGFP-puro
Plasmid#205239PurposeDOX inducible expression of two repeats of PLEKHA5 aa 143-271 (K163A and R164A) fused to a HA-tagged GFP nanobody in mammalian cells from the Sleeping Beauty transposon systemDepositorInsert2xPLEKHA5(143-271)-K163A/R164A-HA-nGFP (PLEKHA5 Human)
UseTransposonTagsHA, Nuclear Export Sequence, mScarlet-i, and nGFP…ExpressionMammalianMutationamino acids 143-271 of PLEKHA5 (GenBank reference…Promotertight TRE promoterAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S-GFP(rc)phiC31
Plasmid#127527PurposePlasmid has a CaMV 35S promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase phiC31 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase phiC31 attachment sites.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S-GFP(rc)Bxb1
Plasmid#127528PurposePlasmid has a CaMV 35S promoter in a forward sequence orientation and an inverted EGFP coding sequence (reverse complement) flanked by attB and attP integrase Bxb1 attachment sites.DepositorInsertEGFP reverse complement coding sequence flanked by attB/attP Integrase Bxb1 attachment sites.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBS598 EF1alpha-EGFPcre
Plasmid#11923PurposeExpresses EGFP-Cre fusion under the control of the EF1alpha promoter; EGFP is human codon-optimized.DepositorAvailable SinceMarch 23, 2007AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EGFP-HOTag3
Plasmid#225677PurposeUsed to generate stable cell lines that express EGFP-HOTag3. This plasmid serves as a control for pLVX-PERK(LD)-EGFP-HOTag3.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLVX-PERK(LD)-EGFP
Plasmid#225680PurposeUsed to generate stable cell lines that express PERK(LD)-EGFP. This plasmid serves as a control for pLVX-PERK(LD)-EGFP-HOTag3.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS305-mAID-Nb(VHHGFP4)
Plasmid#198412PurposeExpress mAID-Nb(VHHGFP4) under the control of ADH1 promoter in budding yeastDepositorInsertmAID-Nb (VHHGFP4)
ExpressionYeastPromoterADH1 promoterAvailable SinceMay 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pALS3-Ma-SUMO-sfGFP-WT
Plasmid#212122PurposeFluorescence control plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses SUMO-sfGFP-WT and M. alvus Pyl-tRNA(6). p15a origin. Tetracycline resistance.DepositorInsertsSUMO-sfGFP-WT
M. alvus Pyl-tRNA(6)
TagsHis6 and SUMOExpressionBacterialPromoteraraC and lppAvailable SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D-Crym-eGFP
Plasmid#200080PurposeTo study u-crystallin protein interactors, control plasmidDepositorInsertGfaABC1D-Crym-eGFP
UseAAV and Mouse TargetingTagseGFPPromoterGfaABC1DAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUBC_mCherry_serinemod_E488QADAR_p2A_yGFP
Plasmid#154786PurposeExpresses mCherry fused to hyperactive ADAR catalytic domain, control plasmid for HyperTRIBEDepositorInsertAdenosine deaminse (Adar Synthetic, Fly)
UseLentiviralTagsGFP, V5, and mCherryExpressionMammalianMutationSynonymized serine to prevent autoediting of ADAR…PromoterUBCAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-Nppa-EGFP
Plasmid#247327PurposeExpresses EGFP under the control of the Nppa promoterDepositorInsertEGFP under the control of the Nppa Promoter
UseAAVExpressionMammalianPromoterNppa proximal promoterAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAB_PalkB_sfgfp_KanR
Plasmid#166503PurposeExpression of sfGFP under control of PalkB promoter. Sensor output plasmid for detection of n-butanol and branched-chain higher alcohols.DepositorInsertsfGFP
UseSynthetic BiologyExpressionBacterialPromoterPalkBAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
114_UBI_iCre_crystGFP
Plasmid#171797PurposeTol2-plasmid ubiquitously expressing iCre (ubiquitin promoter) along with eGFP selection marker (Crystallin promoter -Lens/Eyes-)DepositorInsertoptimised iCre under the control of the Ubiquitin promoter
PromoterUbiquitinAvailable SinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Myr_mCherry-2A-eGFP
Plasmid#194877PurposeRatiometric Myr/Palm_mCherry control probeDepositorInsertMyristoylated/Palmitoylated_mCherry-T2A-GFP
UseAAVExpressionMammalianPromoterhuman SynapsinAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GFP-mirNega
Plasmid#163705PurposepAAV plasmid to induce expression of universal negative control micro-RNA and EGFPDepositorInsertmirNega and EGFP
UseAAVPromoterCAGAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only