We narrowed to 3,846 results for: 28
-
Plasmid#182485PurposeYeast integrative plasmid for expressing fusion protein ERG20-AcNES1, with linker sequence AG4TGGA (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertFPPS-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Linked Free PcPTS
Plasmid#182486PurposeYeast integrative plasmid for expressing fusion protein ERG20-PcPTS, with linker sequence AG4TGGA (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3)DepositorInsertFPPS-PTS
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed Free GFP-NES
Plasmid#182491PurposeYeast integrative plasmid for expressing ERG20 (GAL10 promoter) and fusion protein GFP-AcNES1 (GAL7 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsFPPS
GFP-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10 and GAL7Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-CLCb (EED/QQN)
Plasmid#47422DepositorInsertCLCb EED/QQN (CLTB Human)
TagsEGFPExpressionMammalianMutationEED changed to QQN, in aa20-41 regionPromoterCMVAvailable SinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcmv3-IRG1-H159Q-HA
Plasmid#198183PurposeMammalian expression of HA-tagged human ACOD1 (IRG1) H159QDepositorInsertACOD1 (ACOD1 Human)
TagsHAExpressionMammalianMutationThe histidine in IRG1 at position 159 mutates to …PromoterCMVAvailable SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZS1[TreR-T,LacI-T]
Plasmid#60770PurposeContains PI driving expression TreR-T, and PI driving expression of LacI-T.DepositorInsertsTreR-T
Dimeric LacI with the TAN DBD
UseSynthetic BiologyExpressionBacterialMutationDimeric LacI with the TAN DBD. and LacI/GalR repr…Available SinceJuly 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA8-Flag-LARS(721-1176aa)
Plasmid#139690PurposeExpresses N-teminal Flag tagged aa 721-1176 of LARS1DepositorAvailable SinceJuly 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
[pSK483] pLJC5 Flag-Depdc5(P)
Plasmid#109342PurposeLenti-viral expression of Flag-tagged Depdc5 mutant PDepositorAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pet21a-aGFPnb-enhancer-cys-linker-YbbR-(PAS)5-H6
Plasmid#192788PurposeaGFP nanobody enhancer tagged with cysteine, YbbR and H6 for bacterial expression, purification and labelingDepositorInsertantiGFP nanobody enhancer
TagsH6 and ybbRExpressionBacterialAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p3E-DrCav1
Plasmid#194290PurposeMultisite gateway entry clone for expression of codon optimised zebrafish caveolin1 with fusion tag at the N-terminus. Parton lab clone KRTDepositorInsertcaveolin1 (cav1.S Frog)
UseMultisite gateway entry vectorAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZS1[TreR-T]
Plasmid#60754PurposeContains PI driving expression TreR-T, the Trehalose inducible chimera with the TAN DBD.DepositorInsertsTreR-T
GalS-T
UseSynthetic BiologyExpressionBacterialMutationChimeric LacI/GalR repressor with the TAN DBD and…Available SinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
[pSK476] pLJC5 HA-Depdc5(B)
Plasmid#109345PurposeLenti-viral expression of HA-tagged Depdc5 mutant BDepositorAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
[pSK496] pLJC5 HA-Depdc5(AB)
Plasmid#109346PurposeLenti-viral expression of HA-tagged Depdc5 mutant ABDepositorInsertDepdc5 (DEPDC5 Human)
UseLentiviralTagsHAMutationDIYGD(185-189)GSGSG;EQPLH(371-375)GSGSGAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
[pSK478] pLJC5 HA-Depdc5(P)
Plasmid#109347PurposeLenti-viral expression of HA-tagged Depdc5 mutant PDepositorAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMXs-LN
Plasmid#188231PurposePolycistronic human LIN28 and NANOG were cloned into the pMXs vectorDepositorUseRetroviralExpressionMammalianAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pN1 VAMP2 R125TAG
Plasmid#69877Purposeexpress in mammalian cells for unnatural amino acid incorporation into VAMP2DepositorInsertVAMP2 (Vamp2 Rat)
UseSynthetic BiologyExpressionMammalianMutationAmber and Ochre stop codons in the former linker …Available SinceJan. 25, 2016AvailabilityAcademic Institutions and Nonprofits only