We narrowed to 12,041 results for: SHA;
-
Plasmid#62575PurposeTranslational Luciferase Reporter containing a 926 bp fragment of the RASA1 3'UTR.DepositorAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3.2-Cx43-M100/125/147/213-siResist
Plasmid#49858PurposeEncodes human connexin 43 with M100, M125, M147, and M213 mutated to L and wobble mutations conferring resistance against an siRNADepositorInsertConnexin 43 (GJA1 Human)
ExpressionMammalianMutationMethionine100, Methionine 125, Methionine 147, an…PromoterCMVAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Lyn-SH2-AviTag
Plasmid#214207PurposeBacterial expression of SH2 domain of the Lyn kinase with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-TEV-Grb2-SH2-mCherry-AviTag
Plasmid#214231PurposeBacterial expression of SH2 domain of the Grb2 with N-terminal TEV-cleavable 6xHis tag, C-terminal mCherry, and C-terminal AviTag for Streptavidin bead functionalization for binder selections.DepositorInsertGrb2 SH2 domain (GRB2 Human)
Tags6xHis, AviTag, and mCherryExpressionBacterialPromoterT7Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Lck-SH2-AviTag
Plasmid#214203PurposeBacterial expression of SH2 domain of the Lck kinase with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorInsertLck kinase SH2 domain (LCK Human)
Tags6xHis, AviTag, and SUMOExpressionBacterialPromoterT7Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Blk-SH2-AviTag
Plasmid#214204PurposeBacterial expression of SH2 domain of the Blk kinase with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorInsertBlk kinase SH2 domain (BLK Human)
Tags6xHis, AviTag, and SUMOExpressionBacterialPromoterT7Available SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-His6-SUMO-Hck-SH2-AviTag
Plasmid#214206PurposeBacterial expression of SH2 domain of the Hck kinase with N-terminal Thrombin-cleavable 6xHis tag and SUMO and C-terminal AviTag for Streptavidin bead functionalization for binder selectionsDepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-HP1γ-ΔCSD-EGFP
Plasmid#179934PurposeC terminal fusion of EGFP to mouse HP1γ (Cbx3) containing deletion of entire chromoshadow domain (ΔCSD)DepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_hnRNPA1_allW
Plasmid#224252PurposeBacterial expression of N-terminally 6His-tagged hnRNPA1_allWDepositorInserthnRNPA1_allW (HNRNPA1 Human)
Tags6xHisExpressionBacterialMutationF17W,F25W,F31W,F37W,F43W,Y52W, Y59W, F62W, F69W, …PromoterT7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNK845
Plasmid#219746PurposeMoClo-compatible Level 0 promoterless vector encoding mutant of Neonothopanus nambi luciferase nnLuz_v4 codon-optimised for expression in Pichia pastoris, Homo sapiensDepositorInsertmutant of fungal luciferase
UseLuciferase and Synthetic BiologyMutationI3S, N4T, F11L, I63T, T99P, T192S, A199PAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
PCDF Bravo-PotH-OL3/2sub
Plasmid#216752PurposeStudy the interaction of PotH in E. coli, specifically focusing on the variant in which outer loop 2 (OL2) is substituted with OL3 in its interaction with exogenous peptides.DepositorInsertpotH (potH E. coli (Bacteria))
Tags10x HisExpressionBacterialMutationOuter loop 2 (OL2) with the sequence of [WMGILKNN…Available SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
2X_pX458_pSpCas9(BB)-2A-GFP_eSOX17.2_KO
Plasmid#195495PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the core endoderm distal enhancer of human SOX17DepositorAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCEP4 TAPBPR-TM-TN6
Plasmid#178650PurposeMammalian expression of FLAG-tagged TAPBPR with MHC TM (E205K, R207E, Q209S, Q272S)DepositorInsertTAPBPR (TAPBPL Human)
TagsFLAG and Signal/leader sequence from HLA class I …ExpressionMammalianMutationE205K, R207E, Q209S, Q272S, switched transmembran…PromoterCMVAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 186-199
Plasmid#108285PurposeExpresses residues 186-199 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-283DepositorAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 144-178
Plasmid#108287PurposeExpresses residues 144-178 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-281DepositorAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 4-199 L188A/L192A
Plasmid#108289PurposeExpresses residues 4-199 with L to A mutations at residues 188 and 192 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-284DepositorInsertCHMP1B (CHMP1B Human)
TagsGSTExpressionBacterialMutationchanged L 188 to A, changed L 192 to AAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX2T-TEV CHMP1B 4-199 L192A/L195A
Plasmid#108291PurposeExpresses residues 4-199 with L to A mutations at residues 192 and 195 of CHMP1B with an N-terminal GST tag and a TEV cleavage site; Internal ID: WISP 09-285DepositorInsertCHMP1B (CHMP1B Human)
TagsGSTExpressionBacterialMutationchanged L 192 to A, changed L 195 to AAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Blast-sgMARK3
Plasmid#138706PurposeExpresses a human MARK3-targeting sgRNA and Cas9DepositorAvailable SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
AiP12609 - pAAV-AiE0779m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2609)
Plasmid#191705PurposeAI plasmid ALIAS: AiP12609. Expression of SYFP2 (yellow fluorescent protein) in striatal direct pathway medium spiny neurons (D1-MSNs)DepositorInsertSYFP2
UseAAVMutationnoneAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only