We narrowed to 10,377 results for: plasmids 101
-
Plasmid#162778PurposeBacterial expression of a functionalized anti-mCherry (LaM4) nanobody fused to one tyrosine sulfation (TS) motif. LaM4-1xTS also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-mCherry nanobody fused to a TS site, T7, HA, BAP and His6 epitope
TagsBAP, HA, His6, T7, and TS site from proCCKExpressionBacterialPromoterT7Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT/TO Plk4 KD ∆24-mCherry
Plasmid#80272Purposemammalian expression plasmid for kinase dead Plk4 with multi-phospho degron deletedDepositorInsertPlk4 (PLK4 Human)
TagsmCherryExpressionMammalianMutationdeletion of multi-phospho degron (amino acids 282…PromoterCMVAvailable SinceAug. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET24a-LaM4-2xTS
Plasmid#162779PurposeBacterial expression of a functionalized anti-mCherry (LaM4) nanobody fused to two tyrosine sulfation (TS) motifs. LaM4-2xTS also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-mCherry nanobody fused to two TS sites, T7, HA, BAP and His6 epitope
TagsBAP, HA, His6, T7, and TS site from proCCKExpressionBacterialPromoterT7Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ChromeT-GFP
Plasmid#123316PurposeAAV-mediated expression of ChromeT-GFP under the Syn promoter.DepositorInsertChromeT-GFP
UseAAVTagsGFPExpressionMammalianMutationChannelrhodopsin-2 (ChR2) with mutations A71S/ E9…PromoterSynAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV-EF1a-mCherryLuciferase-W
Plasmid#200101PurposeLentiviral vector expressing mCherry fused with Luciferase at the C-terminusDepositorInsertLuciferase
UseCRISPR and LentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSBtet rtTA G72V SE Δsplice GP Luc
Plasmid#194328PurposeTetracycline inducible expression of Luciferase enzyme in mammalian cells with inclusion of rtTA G72V mutation, splice site and high sensitivity mutations for increased promotor tightnessDepositorInsertLuciferase
UseLuciferaseExpressionMammalianMutationTet-responsive promotor related mutations: G72V i…PromoterTight tet-responsive promotorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapFLEX.(mem).iGlucoSnFR2.mRuby3
Plasmid#244101PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsIgG kappa leader and mRuby3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR(RfxCas13d)-CAG-hfCas13d-pa
Plasmid#233036PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged hfCas13d from a CAG promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and hfCas13d
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR(RfxCas13d)-CAG-CasRx-pa
Plasmid#233035PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged CasRx from a CAG promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and CasRx
UseAAVAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-EFS-CasRx-T2A-mCherry-pA
Plasmid#192481PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterU6/EFSAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lutheran-CD4d3+4-bio
Plasmid#73101PurposeEXPRESs plasmid for human erythrocyte surface proteins encoding Lutheran with rat CD4d3+4-bioDepositorInsertLutheran (BCAM Human)
Tagsbiotinylation peptide and ratCD4d3+4ExpressionMammalianPromoterCMVAvailable SinceMarch 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
MSCV-mouseAtoh1-IRES-GFP
Plasmid#73572PurposeMammalian retroviral expression of Atoh1DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
YAF2_pLX307
Plasmid#98383PurposeLentiviral expression of YAF2DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
-
pAAV-U6-DR30(SapI)-CMV-intron-MCS-pA
Plasmid#192496PurposeTo express CasRX gRNA and contains MCS to insert coding region of interestDepositorInsertCasRx
UseAAVMutationNoPromoterCMVAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-DjCas13d-P2A-mCherry-pA
Plasmid#233027PurposeTo Express HA tagged DjCas13d and mcherry from the mammalian EFS promoter. The DjCas13dx and mCherry are separated by a P2A siteDepositorInsertDjCas13d/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-P2A-mCherry-pA
Plasmid#233025PurposeTo Express HA tagged CasRX and mcherry from the mammalian EFS promoter. The CasRx and mCherry are separated by a P2A siteDepositorInsertCasRx/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-hfCas13d-P2A-mCherry-pA
Plasmid#233026PurposeTo Express HA Tagged hfCas13d and mcherry from the mammalian EFS promoter. The hfCas13d and mCherry are separated by a P2A siteDepositorInserthfCas13d/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only