We narrowed to 6,180 results for: cas9 expression plasmid
-
Plasmid#124772Purpose3rd generation lentiviral plasmid to co-express a guide RNA and mOrangeDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only
-
AP575-1
Plasmid#71277PurposeExpresses 3Xflag::tagRFP::myc in bacteriaDepositorInserttagRFP
Tags3xFlag and mycExpressionBacterialAvailable SinceNov. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
AP682-1
Plasmid#70050PurposeExpresses TEV::eGFP::myc::3Xflag in bacteriaDepositorInserteGFP
TagsTEV and myc::3XflagExpressionBacterialAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
sg1+sg2+sg3
Plasmid#113969PurposeTriple short guide RNA targeting GTATAGCATACATTATACG, TACCACATTTGTAGAGGTT & CAATGTATCTTATCATGTCDepositorInsertsg1+sg2+sg3
ExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDM097
Plasmid#216819PurposeAspergillus nidulans codon-adjusted mStayGold fluorescent protein, includes linker for N-terminal or internal tagging.DepositorInsertmStayGold
TagsFLAG-(SGGS)x2-XTEN16-(GGGGS)x3 and c4-(GGGGS)x2-X…ExpressionBacterialMutationAspergillus nidulans codon-adjustedAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57-sgRNA expression vector
Plasmid#51132PurposeFor in vitro transcription of sgRNA from the T7 promoter.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterT7Available SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_nat
Plasmid#184918PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_nat recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_mic
Plasmid#184920PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_mic recombines in vivo with a PCR product from pEasyG3_zeo/nat/hph.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only