We narrowed to 6,890 results for: Cad
-
Plasmid#198783PurposeDrives specific expression in the ASK neuronsDepositorInsertPsra-9-GAL4-SK(DBD)-VP64
UseTagsExpressionWormMutationPromoterAvailable sinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-NIrD-Mefv iso1
Plasmid#92108Purposeinducible expression in eukaryotic cellsDepositorInsertMefv isoform1 (Mefv Mouse)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-Nop4 WT
Plasmid#169261PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-Nop4 WTDepositorInsertNop4 WT (NOP4 Budding Yeast)
UseTags3xFLAGExpressionYeastMutationPromoterGPDAvailable sinceDec. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJFRC210-10XUAS-FRT>STOP>FRT-myr::smGFP-OLLAS
Plasmid#63170PurposeGAL4-responsive UAS “flp-On” spaghetti monster GFP-OLLAS reporterDepositorInsert"spaghetti monster GFP-OLLAS"
UseTagsN-myristoylationExpressionInsectMutationPromoterAvailable sinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-MTS-FLAG-LOV*
Plasmid#202208PurposePlasmid for the generation of a lentiviral vector encoding the photoproximity labeling catalyst LOV* fused to the mitochondria targeting sequence (MTS) in mammalian cellsDepositorInsertCytochrome c oxidase subunit 4 isoform 1, mitochondrial, aa 1-24
UseLentiviralTagsFLAG and LOV*ExpressionMutationPromoterEf1aAvailable sinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
RNA polymerase beta prime subunit FLAG
Plasmid#102337PurposeTargeting plasmids for replacing the S. elongatus PCC 7942 genomic copy of Synpcc7942_1524 (Beta prime subunit of RNA polymerase) with a C-terminal FLAG tagged variant.DepositorInsertRNAP Beta Prime Subunit with C-terminal FLAG TAG
UseTags3x FLAG with 3X GSGS linkerExpressionMutationPromoterAvailable sinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3 Flag BimL (AA)
Plasmid#24240DepositorInsertBim L(AA) (BCL2L11 Human)
UseTagsFlagExpressionMammalianMutationchanged Threonine 56 to Alanine changed Serine …PromoterAvailable sinceMay 10, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGEX6p-Meis1a
Plasmid#78144Purposebacterial expression of GST-Meis1aDepositorInsertMeis1a (Meis1 Mouse)
UseTagsGSTExpressionBacterialMutationPromoterAvailable sinceJune 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOPS0385
Plasmid#133235PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with NoP (pOGG113), gusA (pOGG083) and T-pharma (pOGG003)
UseTagsExpressionBacterialMutationDomesticated for Golden Gate cloningPromoterAvailable sinceApril 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOPS0386
Plasmid#133236PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with NoP (pOGG113), celB (pOGG050) and T-pharma (pOGG003)
UseTagsExpressionBacterialMutationDomesticated for Golden Gate cloningPromoterAvailable sinceApril 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOPS0383
Plasmid#133233PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with NoP (pOGG113), sfGFP (pOGG037) and T-pharma (pOGG003)
UseTagsExpressionBacterialMutationDomesticated for Golden Gate cloningPromoterAvailable sinceApril 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPrhaBADAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRRG304-Ndk
Plasmid#99072PurposedsRNA and riboprobe synthesis for Schmidtea mediterranea Ndk (nou darake)DepositorInsertNdk (nou darake) in situ probe
UseT/a cloning vector for dsrna generation and the g…TagsExpressionMutationPromoterAvailable sinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3_PKA-CαN (K29,30A)-mVenus
Plasmid#168485PurposeMammalian expression of the K29,30A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus.DepositorInsertthe K29,30A mutant of the N-terminal 47 residues of mouse PKA catalytic subunit α C-terminally tagged by monomeric Venus
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
PumC
Plasmid#87321PurposePumHD w/each unit mutated to bind C (as in Fig. 1C; unit 6 is the Pumby for C)DepositorInsertPumilio protein mutant (PUM1 Human)
UseSynthetic BiologyTagsExpressionMammalianMutationall 8 units mutated to bind CPromoterUBCAvailable sinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pet16b ALIX Bro1 (1-359)
Plasmid#80641PurposeResidues 1-359 of ALIX; Bacterial Expression Vector; N-term His-tag; Sundquist Lab Internal ID: WISP11-428DepositorInsertALIX Bro1, residues 1-359 (PDCD6IP Human)
UseTagsHis TagExpressionBacterialMutationResidues 1-359PromoterT7Available sinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-H2-Ld
Plasmid#135519PurposeMammalian expression of myc-tagged H2-LdDepositorInsertH2-Ld
UseTagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-MEKK1-1-1493
Plasmid#21632DepositorInsertmitogen-activated protein kinase kinase kinase 1 (Map3k1 Rat)
UseTagsHAExpressionMammalianMutationPromoterAvailable sinceFeb. 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Fah_W
Plasmid#163087Purposeexpressing mouse wild type FAH in mammalian cellsDepositorInsertFah_W
UseTagsMyc-HisExpressionMammalianMutationPromoterCMVAvailable sinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pACUH-GFP1-10 mitochondrial matrix
Plasmid#172063PurposeUAS vector to express GFP1-10 in the mitochondrial matrixDepositorInsertGFP1-10 mitochondrial matrix
UseTagsExpressionInsectMutationPromoterAvailable sinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only