We narrowed to 4,490 results for: Gca
-
Plasmid#160788PurposeSuppress NTHL1DepositorInsertshNTHL1_2
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P NTHL1_1
Plasmid#160787PurposeSuppress NTHL1DepositorInsertshNTHL1_1
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P EXO5_2
Plasmid#160784PurposeSuppress EXO5DepositorInsertshEXO5_2
UseLentiviralAvailable SinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_AAVS1_sgRNA_4
Plasmid#155090Purposelentiviral plasmid expressing Cas9 and gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_4
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-3'UTR
Plasmid#136044PurposeUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTBL436 HEK293site3EQR sgRNA
Plasmid#126445PurposeTo cut the human HEK293 site3 locus for integration.DepositorInsertspacer against human HEK293 site3 with NGAG PAM
ExpressionMammalianPromoterhuman U6Available SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330 Gatad2a sgRNA (for deletion)
Plasmid#110814PurposeExpressed sgRNA for generating Gatad2a deletion (knockout ) in mouse cell linesDepositorInsertmGataD2a (Gatad2a Mouse)
ExpressionMammalianAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHOXC13.1.0-gDNA
Plasmid#113795PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor HOXC13DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF211.1.0-gDNA
Plasmid#112478PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF211DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-
pCRRNA-G11-R0
Plasmid#101805PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G0-R11
Plasmid#101808PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G0-R18
Plasmid#101813PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G14-R0
Plasmid#101806PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G10-R0
Plasmid#101804PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN279
Plasmid#91654PurposeExpress sgRNA targeting human PTNDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ARID4B_1
Plasmid#101078PurposeEncodes gRNA for 3' target of human ARID4BDepositorInsertgRNA against ARID4B (ARID4B Human)
UseCRISPRAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1852-3 pHR: U6-SpsgCD95-2 CMV-EGFP
Plasmid#84252PurposeExpresses Sp sgCD95-2 gRNA with an EGFP fluorescent markerDepositorInsertSp sgCD95-2
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO1-puro-U6-sgRNA-KANK3
Plasmid#69238PurposeU6 driven SpCas9 sgRNA expression for KANK3 siteDepositorAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only