We narrowed to 24,121 results for: CRISPR
-
Plasmid#205969PurposeMWEE01000013 Cas5-HNH operon (E. coli codon optimized) + CRISPR array in pACYCDuet-1 Lac promotersDepositorInsertCas5-HNH proteins and CRISPR array
ExpressionBacterialPromoterLac (proteins), pJ23119 (crRNA)Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRELA
Plasmid#83944PurposeLentiviral vector expressing an sgRNA targeting RELA NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgRELA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSNR52-sgTET
Plasmid#46923PurposeYeast CEN/ARS vector (Ura3) that contains sgRNA controlled by SNR 52 promoter, targeting endogenous TRE elements of pTET07 promoterDepositorInsertsgRNA targeting endogenous TRE elements of pTET07 promoter
UseCRISPRExpressionYeastPromoterSNR52Available SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJZC32
Plasmid#62327PurposesgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQCas12j2
Plasmid#189780PurposeGateway entry plasmid (attL1 & attR5) expressing NLS-Cas12j2-NLS, without promoterDepositorInsertCas12j2
UseCRISPR; Gateway compatible cas12j2 entry cloneTagsNLSExpressionPlantAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2818_Blasti_pPB: CAG-PYL1-KRAB-IRES-Blasti-WPRE-SV40PA PGK-ABI-tagBFP-SpdCas9-FKBP_F36V
Plasmid#187959PurposeExpressed ABA-inducible dimerizing KRAB-dCas9 system, with KRAB-IRES-Blasticidin resistance under CAG promoter and tagBFP-dCas9-FKBP12 (F36V mutant) degron under PGK promoter in a piggyBac plasmid.DepositorInsertsBlasticidin resistance
FKBP12_F36V
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
PRKAA1 gRNA (BRDN0001146526)
Plasmid#76253Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIKFYVE gRNA (BRDN0001148075)
Plasmid#76891Purpose3rd generation lentiviral gRNA plasmid targeting human PIKFYVEDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK4 gRNA (BRDN0001147987)
Plasmid#76075Purpose3rd generation lentiviral gRNA plasmid targeting human STK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ROCK2 gRNA (BRDN0001147800)
Plasmid#76349Purpose3rd generation lentiviral gRNA plasmid targeting human ROCK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Tsc2-g2)-PGKpuroBFP-W
Plasmid#105040PurposeLentiviral gRNA plasmid targeting mouse Tsc2 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-Cas12j2
Plasmid#173924PurposeGateway entry plasmid (attL1 & attR5) expressing NLS-Cas12j2-NLSDepositorInsertNLS-Cas12j2-NLS
UseCRISPRTagsNLSExpressionPlantAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1C gRNA (BRDN0001148198)
Plasmid#77665Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1CDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1C gRNA (BRDN0001145736)
Plasmid#77666Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1CDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RIPK1 gRNA (BRDN0001148444)
Plasmid#76533Purpose3rd generation lentiviral gRNA plasmid targeting human RIPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RIPK1 gRNA (BRDN0001149461)
Plasmid#76532Purpose3rd generation lentiviral gRNA plasmid targeting human RIPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCK668
Plasmid#192637PurposeExpresses dCas9-NG and MCP-SoxS(R93A/S101A) on p15A-CmRDepositorInsertsSp.pCas9-dCas9-NG
BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPR and Synthetic BiologyMutationSoxS has R93A and S101A mutations and dCas9-NG ha…PromoterBBa_J23107 and Sp.pCas9Available SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G3
Plasmid#86611PurposeExpresses the ATP1A1 G3 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 4. Px330-like plasmidDepositorInsertATP1A1 G3 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
TRIM27 gRNA (BRDN0001145893)
Plasmid#77516Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM27DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK4 gRNA (BRDN0001149002)
Plasmid#76074Purpose3rd generation lentiviral gRNA plasmid targeting human STK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dAaCas12b-Act3.0
Plasmid#158413PurposeCRISPR-Act3.0 system containing dAaCas12b-VP64 fusion protein, T2A linked MS2-SunTag fusion protein, and ScFv-sfGFP-2xTAD activator.DepositorInsertdAaCas12b-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001162235)
Plasmid#80261Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIKFYVE gRNA (BRDN0001148312)
Plasmid#76893Purpose3rd generation lentiviral gRNA plasmid targeting human PIKFYVEDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
non-targeting control gRNA (BRDN0001149469)
Plasmid#80257Purpose3rd generation lentiviral gRNA plasmid, non-targeting control gRNADepositorInsertNon-targeting control gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIP5K1C gRNA (BRDN0001145164)
Plasmid#77667Purpose3rd generation lentiviral gRNA plasmid targeting human PIP5K1CDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G2
Plasmid#86610PurposeExpresses the ATP1A1 G2 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 exon 4. Px330-like plasmidDepositorInsertATP1A1 G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMEL15
Plasmid#107921Purposenat based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS12
Plasmid#107926Purposehph based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP15-AAV-H1/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82701PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA that targets exon 3 of the mouse Tet2 locus. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO gRNA Expression Cassette Containing Tet2 gRNA
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYPQ165
Plasmid#109327PurposeGateway entry plasmid (attL1 & attR5) expressing 3_FLAG-NLS-zCas9-NLS driven by egg cell-specific promoterDepositorInsertzCas9
UseCRISPR; Gateway compatible zcas9 entry cloneTags3x FLAG, NLS and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterPromoter EC1.2 enhancer fused to EC1.1 promoterAvailable SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only