We narrowed to 26,320 results for: sta
-
Plasmid#138467PurposeExpresses SUMO3-tagged ORF24-NTD-Strep in bacteriaDepositorInsertORF24 (ORF24 KSHV (HHV-8))
UseTagsSUMO3 and Strep-Tag IIExpressionBacterialMutationAmino acids 2-201PromoterT7Available sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPK1E-1-gfp
Plasmid#48133PurposeShuttle vector E. coli/B.meg.; gfp-expression under control of RNAP-K1E-inducible promoterDepositorInsertgfp
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceOct. 21, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOneZeo-ORF18(E36A_L37A)-3xFLAG
Plasmid#129758PurposeDox inducible expression of KSHV ORF18-3xFLAG (E36A_L37A) in mammalian cellsDepositorInsertORF18 (ORF18 Kaposi's sarcoma-associated herpesvirus (HHV-8))
UseLentiviralTags3xFLAGExpressionMammalianMutationchanged Glutamic acid 36 to Alanine and Leucine 3…PromoterTRE3Gs and Tet inducible promoterAvailable sinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-Sema4DdeltaC
Plasmid#51602Purposeexpresses Sema4D lacking C terminusDepositorInsertSema4DdeltaC (Sema4d Mouse)
UseTagsmycExpressionMammalianMutationLast 69 amino acids of Sema4D C-terminus are dele…PromoterCMVAvailable sinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJ02B2Gm:Rm_AF
Plasmid#66061PurposeMoClo Device: FACS Standard Color Controls - High GFP (first unit) & RFP (second unit) expression cassette - Ampicillin plasmid [A:J23102:B:BCD2:C:E0040m:D:B0015:E:J23102:B:BCD2:C:E1010m:D:B0015:F]DepositorInsertFACS Controls
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJ02B2Rm:Gm_AF
Plasmid#66062PurposeMoClo Device: FACS Standard Color Controls - High RFP (first unit) & GFP (second unit) expression cassette - Ampicillin plasmid [A:J23102:B:BCD2:C:E1010m:D:B0015:E:J23102:B:BCD2:C:E0040m:D:B0015:F]DepositorInsertFACS Controls
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEX Bks-SH2
Plasmid#46406DepositorInsertBks (STAP2 Human)
UseTagsAviTag, GST, and PreScissionExpressionBacterialMutationcontains amino acids 141-266PromoterTacAvailable sinceJuly 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPK1E-1+t-gfp
Plasmid#48131PurposeShuttle vector E. coli/B.meg.; gfp-expression under control of RNAP-K1E-inducible promoterDepositorInsertgfp
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceOct. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPK1E-2+t-gfp
Plasmid#48132PurposeShuttle vector E. coli/B.meg.; gfp-expression under control of RNAP-K1E-inducible promoterDepositorInsertgfp
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceOct. 21, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRCA376 - pBA904 Puro-T2A-GFP NTC guide (pRCA360 backbone)
Plasmid#238167PurposeLentiviral CRISPR guide vector expressing a non-targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertNon-targeting sgRNA
UseCRISPR and LentiviralTagsGFPExpressionMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
TAK4
Plasmid#227094PurposeLuciferase reporter vector with MMTV 5' Element cloned downstream of luciferase gene in pHMRΔelucDepositorInsertMMTV insert spanning from R region to 400 bp of Gag
UseLuciferaseTagsExpressionMutationPromoterAvailable sinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
act-3p(long):rfp
Plasmid#202330PurposeThe act-3 promoter drives expression of TurboRFP in the pharynx, spermatheca, and body wall of C. elegans.DepositorInsertsact-3p(long) promoter
TurboRFP
UseTagsExpressionWormMutationPromoterThis is a promoter sequence for C. elegans act-3 …Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
opt.a_pSTC0-zeo
Plasmid#202347PurposeDesign opt.a (greedy optimization without distance constraints) in modified pSTC0 vector in which kan resistance cassette is replaced with zeo resistance cassetteDepositorInsertopt.a
UseTagsExpressionMutationPromoterAvailable sinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
opt.b_pSTC0-zeo
Plasmid#202348PurposeDesign opt.b (parallel tempering optimization without distance constraints) in modified pSTC0 vector in which kan resistance cassette is replaced with zeo resistance cassetteDepositorInsertopt.b
UseTagsExpressionMutationPromoterAvailable sinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
eGFP-SUN1ΔN
Plasmid#213508PurposeExpresses human eGFP-SUNΔN in mammalian cellsDepositorInserteGFP-SUNΔN
UseTagsExpressionMammalianMutationSUN1ΔN has the first 138 amino acid (lamina domai…PromoterCMVAvailable sinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDB_052
Plasmid#216082Purposefor stable fly cell lines; Hygromycin resistance gene; for genome integration by spontaneous insertion, destination vectorDepositorHas ServiceCloning Grade DNAInsertHygromycin resistance gene
UseDestinationTagsExpressionInsectMutationPromoterAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MTOR-F2108L_DARIC(1)_CD19-scFv_AAV6_Donor
Plasmid#211905PurposeVector for AAV6 donor production. Targeted CD19-scFv DARIC transgene integration to the MTOR locus with the dominant rapamycin resistance MTOR-F2108L mutation via homology-directed repair.DepositorInsertDARIC-CD19-scFv
UseAAVTagsExpressionMammalianMutationPromoterhPGK1Available sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -