We narrowed to 24,475 results for: crispr
-
Plasmid#83487PurposeBacterial expression of WT L. shahii C2c2 CRISPR effectorDepositorInsertLsh_C2c2_WT
UseCRISPRTagsHis6-MBPExpressionBacterialAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCBC-MT3T4
Plasmid#50595PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT3, gRNA scaffold, U6-26t plus, OsU3p, T4
UseCRISPR; Pcr templateExpressionPlantAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE-VQRCas9
Plasmid#101740Purposeexpression of an optimized Cas9 for base-editing in zebrafishDepositorInsertrAPOBEC1-XTEN-zCas9(VQR)-UGI-NLS
UseCRISPRExpressionMammalianMutationD10A, VQR mutationsPromoterCMVAvailable SinceJan. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSIMcpf1
Plasmid#153034PurposeFor CRISPR-Cas12a genome editing in E. coli. Contains; constituitively expressed Ascpf1 gene, a heat-inducible lambda red recombination system, an arabinose-inducible CRISPR array targeting pMB1.DepositorInsertAscpf1
ExpressionBacterialAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSBY1_FnCpf1cg
Plasmid#104622PurposeCRISPR system used to genome editing in Mycobacterium smegmatis, expresses Fn CPf1DepositorInsertFnCpf1
UseCRISPRExpressionBacterialMutationcodon-optimized C.glutamicumPromoterhsp60Available SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEJS477-pHAGE-TO-Spy dCas9 3XmCherry-SgRNA/Telomere-All-in-one
Plasmid#85717PurposeExpresses dSpyCas9-3XmCherry and telomere-targeting Spy sgRNADepositorInsertsSp dCas9
telomere sgRNA
UseCRISPR and LentiviralTags3XmCherryExpressionMammalianPromoterCMV-TO and U6Available SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRCA893 - pBA904 Puro-T2A-BFP KLF5 g1 CRISPRa guide guide (pRCA594 backbone) 666
Plasmid#238186PurposeLentiviral CRISPR guide vector expressing a KLF5 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA895 - pBA904 Puro-T2A-BFP KLF4 g1 CRISPRa guide guide (pRCA594 backbone) 668
Plasmid#238187PurposeLentiviral CRISPR guide vector expressing a KLF4 sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
p426-SNR52p-gRNA.csr-1.Y-SUP4t
Plasmid#68060PurposegRNA for csr-1 locus in N. crassaDepositorInsertgRNA for csr-1 locus
UseCRISPR; N. crassa, fungiExpressionYeastPromoterSNR52Available SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
Eef1a-1955/-1>nls::Cas9::nls
Plasmid#59987PurposeEef1a (EF1alpha) promoter driving nls::Cas9::nlsDepositorInsertnls::Cas9::nls
UseCRISPRMutationReverted mutations from dCas9 to wiltdtypePromoterCiinte.Eef1a (EF1alpha) -1955/-1Available SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
AsCpf1-2NLS
Plasmid#102565Purposebacterial expression of AsCpf1-2NLSDepositorInsertAsCpf1
Tags6xHis-MBP-TEV and HA-2xSV40NLSExpressionBacterialPromoterT7Available SinceDec. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAC153-dual-dCas9VP96-sgExpression
Plasmid#48239PurposeDual expression construct expressing both dCas9VP96 and sgRNA from separate promotersDepositorInsertdCas9
UseCRISPRTagsHA-Tag, HA-tag, and VP96ExpressionMammalianMutationD10A H840AAvailable SinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJK412
Plasmid#155371PurposedCas9 oscillator v1 (dCRv1) + [dCas9 + PA4-mVenus]DepositorInsertsdCas9 (bacteria)
PA4-mVenus
dCas9 sgRNA oscillator v1
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_1
Plasmid#155081PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_4
Plasmid#155084PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_Ptbp_ex8_2
Plasmid#155082PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of mouse Ptbp exon 8 using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SpdCas9-VP64
Plasmid#115794PurposeExpresses SpdCas9-Vp64 fusion protein when packaged into AAVDepositorInsertVP64
UseAAVTags3XFLAG and dCas9-VP64ExpressionMammalianPromoterCMVAvailable SinceJan. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
p2CT-His-MBP-Lse_C2c2_WT
Plasmid#83486PurposeBacterial expression of WT L. seeligeri C2c2 CRISPR effectorDepositorInsertLse_C2c2_WT
UseCRISPRTagsHis6-MBPExpressionBacterialAvailable SinceNov. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYN2_1
Plasmid#184757PurposePlasmid for genome editing by CRISPR/Cas9DepositorInsertsCas9
sgRNA scaffold where sfGFP is replaced with gRNA protospacer of interest, which will be proceeded by the HDV Ribozyme
UseSynthetic BiologyTags2xNLSExpressionBacterial and YeastPromoterPGK1 and tRNA-Phe-HDV RibozymeAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only