We narrowed to 11,499 results for: aga
-
Plasmid#177031PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInserttryptophan decarboxylase
UseSynthetic BiologyAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0764
Plasmid#177030PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsertsecologanin synthase; CYP72C
UseSynthetic BiologyAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0763
Plasmid#177029PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsertloganic acid O-methyltransferase
UseSynthetic BiologyAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0762
Plasmid#177028PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsert7-deoxyloganic acid hydroxylase; CYP72A224
UseSynthetic BiologyAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0062
Plasmid#177027PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsert7-deoxyloganetic acid glucosyl transferase; UGT709C2
UseSynthetic BiologyAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0060
Plasmid#177024PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsertiridoid synthase
UseSynthetic BiologyAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0059
Plasmid#177023PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsert8-hydroxygeraniol oxidoreductase; 10-hydroxygeraniol oxidoreductase; alcohol dehydrogenase 10
UseSynthetic BiologyAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEPQD0CM0063
Plasmid#177021PurposeLevel 0 CDS (with stop codon) part for MoClo assembly, AATG-GCTTDepositorInsertgeraniol synthase
UseSynthetic BiologyMutationtransit peptide removedAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBAD-DiB1
Plasmid#168800PurposeFluorogen activating protein (FAP) DiB1DepositorInsertFluorogen activating protein DiB1
TagsHis-tagExpressionBacterialPromoteraraBADAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBAD-DiB3
Plasmid#168802PurposeFluorogen activating protein (FAP) DiB3DepositorInsertFluorogen activating protein DiB3
TagsHis-tagExpressionBacterialPromoteraraBADAvailable SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP3
Plasmid#113974PurposeSingle short guide RNA targeting CGTGATGTTGTACCGCTTC in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sg1
Plasmid#113966PurposeSingle short guide RNA targeting GTATAGCATACATTATACGDepositorInsertsg1
PromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYMCR2_Gb_PMLTSS
Plasmid#140285PurposeCRISPR/Cas9 plasmids encoding sgRNA targeting TSS of PML for knock-inDepositorInsertCas9
ExpressionMammalianPromoterCBHAvailable SinceMay 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS424-ysg(NT)
Plasmid#138258PurposeExpression of a non-targeting sgRNA to be used as a control in a yeast dual reporter systemDepositorInsertNontargeting sgRNA
UseCRISPRExpressionYeastPromoterSNR52Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-hsg(NT:NT)
Plasmid#138260PurposeExpression of a non-targeting sgRNA to the left and right of iCas9 recognition site to be used as a control in Traffic Light reporter systemDepositorInsertNontargeting sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-ysg(NT)
Plasmid#138263PurposeSubcloning and expression of non-targeting sgRNA for use in yeast dual reporter system.DepositorInsertNontargeting sgRNA
UseCRISPRExpressionYeastPromoterSNR52Available SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTK-EdnrbE2-Cerulean
Plasmid#127771PurposeEnhancer reporter construct containing the chicken EdnrB enhancer, E2 driving Cerulean activityDepositorInsertednrbE2
UseEnhancer reporter constructAvailable SinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sox3gRNA-T2
Plasmid#127778PurposeChicken sox3 gRNA target site 2, cloned into the pU6 sgRNA (backbone #92359)DepositorInsertsox3gRNAT2
UseCRISPRAvailable SinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only