We narrowed to 41,789 results for: LAT
-
Plasmid#8804DepositorInsertBim (Bcl2l11 Mouse)
ExpressionMammalianAvailable SinceMarch 23, 2006AvailabilityAcademic Institutions and Nonprofits only -
MERS-coV-NSP3-c001
Plasmid#173085PurposeExpression of recombinant fusion protein in E. coliDepositorInsertrep (orf1ab Middle East respiratory syndrome-related coronavirus (isolate United Kingdom/H123990006/2012) (MERS-CoV))
TagsmCeruleanExpressionBacterialMutationD1109-D1275, codon optimizedAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBabe EGFR insertionH
Plasmid#32067DepositorAvailable SinceSept. 19, 2011AvailabilityAcademic Institutions and Nonprofits only -
TMED5-bio-His
Plasmid#53338PurposeExpresses full-length Transmembrane emp24 domain-containing protein 5 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertTMED5 (TMED5 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC32
Plasmid#62327PurposesgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBEST-p70a-UTR1-NTerm 6xHis-zmADH-T500
Plasmid#92228PurposeExpression of zmADH using the p70a promoter and UTR1DepositorInsertNTerm 6xHis Tagged zmADH
UseSynthetic Biology; Cell free protein synthesis (c…Tags6xHisExpressionBacterialPromoterp70aAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
VIPR1
Plasmid#51865PurposeExpresses full-length Vasoactive intestinal polypeptide receptor 1 precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertVIPR1 (VIPR1 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
Dll1ICD-HPC4 pBacPAK8-3
Plasmid#17333DepositorAvailable SinceFeb. 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
ACVR1B-bio-His
Plasmid#51640PurposeExpresses full-length Activin receptor type 1B precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertACVR1B (ACVR1B Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBabe EGFR Del2
Plasmid#32065DepositorAvailable SinceSept. 19, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMT-ubb-cytoBirA-2a-mCherry
Plasmid#79885PurposeUbiquitin promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein; flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
Tags3x HAExpressionBacterialPromoterUbiquitinAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
SCUBE1-bio-His
Plasmid#53415PurposeExpresses full-length Signal peptide, CUB and EGF-like domain-containing protein 1 ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertSCUBE1 (SCUBE1 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCin4-3xFLAG-MKL1 S454A
Plasmid#19844DepositorInsertMKL1 S454A (MRTFA Human)
Tags3xFLAGExpressionMammalianMutationchanged Serine 454 to AlanineAvailable SinceDec. 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-Cx43-siResist
Plasmid#49852PurposeEncodes human connexin 43 with wobble mutations conferring resistance against an siRNADepositorInsertConnexin 43 (GJA1 Human)
ExpressionMammalianMutationContains several wobble mutations to confer resis…PromoterCMVAvailable SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pONSY-CoNMM:mCherry
Plasmid#111878PurposeThis plasmid expresses mCherry fluorescent protein fused to an N-Myristoylation motif (NMM) from the endogenous Src2 gene (CAOG_06360). It can be used to visualize the membrane and filopodia.DepositorInsertCapsaspora N-Myristoylation motif (CoNMM) from the Src2 gene fused to mCherry
UseCapsaspora owczarzakiTagsmCherryPromoterElongation Factor 1 alpha (EF1a) from CapsasporaAvailable SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
RBM38
Plasmid#155899PurposeFor use in RBP tethering screenDepositorAvailable SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDN-G1Gh
Plasmid#44507DepositorInsertsUseSynthetic Biology; Expression regulator/reporterExpressionYeastMutationTwo tandem tet operators (2XtetO2) downstream of …PromoterPGal1-D12 promoterAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFSynW Substance P-pHluorin IRES mRuby3
Plasmid#195699PurposeLentiviral plasmid encoding first 68 residues of mouse preprotachykinin with a C-terminal pHluorin tag followed by an internal ribosomal entry site followed by mRuby3 under the human synapsin promoterDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMT-MCS-cytoBirA-2A-mCherry_Ras
Plasmid#80058PurposeMCS for cloning promoter to drive HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
Tags3x HAExpressionBacterialAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
B4GALT1-Dox
Plasmid#124633PurposeDoxycycline-inducible B4GALT1 expression in mammalian cellsDepositorInsertsBeta-(1,4)-Galactosyltransferase 1
Tetracycline repressor A3 mutant
TagFP635
ExpressionMammalianPromoterTRE-tight and hEF1aAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only