We narrowed to 9,067 results for: sgRNA
-
Plasmid#204639PurposeExpression of trancated AsCas12f sgRNA in mammalian cellsDepositorInserttrancated AsCas12f sgRNA (sgRNA-v2)
ExpressionMammalianPromoterU6Available sinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA-Adra1b
Plasmid#184293PurposeA single vector containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA targeting Adra1bDepositorInsertssgRNA-Adra1b
sgRNA-Adra1b
UseAAV and CRISPRExpressionMammalianAvailable sinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEJS654 All-in-One AAV-sgRNA-hNmeCas9
Plasmid#112139PurposeDelivery of human-codon-optimized Cas9 from Neisseria meningitidis (NmeCas9) and its single-guide RNA in a single AAV vector for in vivo genome editing.DepositorInsertssgRNA scaffold
Human-codon-optimized NmeCas9
UseAAV, CRISPR, and Mouse TargetingExpressionMammalianPromoterU1a and U6Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti SpBsmBI sgRNA Puro
Plasmid#62207PurposeAn empty sgRNA expression vector for expression of sgRNA for Sp Cas9 (3rd generation lentiviral vector)DepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterU6Available sinceMay 27, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJR107
Plasmid#187245PurposeLentiviral sgRNA vector for CROP-seq with mU6 sgRNA promoter, CR1 constant region, and UCOE EF1alpha driving PURO-GFP marker expressionDepositorInsertLentiviral sgRNA vector for CROP-seq with mU6 sgRNA promoter
UseLentiviralAvailable sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSmart-Nm-sgRNA-BbsI
Plasmid#49157PurposePlasmid for cloning spacer into sgRNA for NmCas9DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available sinceFeb. 13, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC1-A_sgBC1-C
Plasmid#154196PurposeLentiviral expression plasmid encoding two sgRNAs for targeting of the CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC1-A, sgRNA-BC1-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available sinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA-Target1 (MpRTN1)
Plasmid#186291PurposeGateway entry vector for sgRNA (target 1: MpRTN1). Transient expression of sgRNA (Target 1: MpRTN1) for MpRTN1 in plant cellsDepositorInsertsgRNA-Target1
UseCRISPRAvailable sinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJR106
Plasmid#187244PurposeLentiviral sgRNA vector for CROP-seq with mU6 sgRNA promoter, CR1 constant region, and UCOE EF1alpha driving PURO-BFP marker expressionDepositorInsertLentiviral sgRNA vector for CROP-seq with mU6 sgRNA promoter
UseLentiviralAvailable sinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHEE401
Plasmid#71286PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertssgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 promoter and U6-26p Arabidopsis U6 gene pro…Available sinceJan. 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGEM-2t
Plasmid#159752PurposeCRISPR/Cas9 genome editing in plants; a template for PCR-derived fragments used in the assembly of polycistronic transcripts, where sgRNAs are separated by an Arabidopsis alanine tRNA.DepositorPublicationInsertsgRNA
UseCRISPRAvailable sinceOct. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMpGE_En03-sgRNA_Target2 (Mpphot)
Plasmid#186727PurposeGateway entry vector for sgRNA (target 2: Mpphot [negative control]). Transient expression of sgRNA (target 2: Mpphot) in plant cells.DepositorInsertsgRNA_Mphot
ExpressionBacterialAvailable sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMpGE_En03-sgRNA_Target1 (Mpphot)
Plasmid#186726PurposeGateway entry vector for sgRNA (target 1: Mpphot [positive control]). Transient expression of sgRNA (target 1: Mpphot) in plant cells.DepositorInsertsgRNA_Mphot
ExpressionBacterialAvailable sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAtU6-sgRNA
Plasmid#119775PurposeExpression of a target sgRNA in potatoDepositorInsertAtU6-SmR-sgRNA
ExpressionPlantPromoterAtU6Available sinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pNICKclos2.0
Plasmid#73228PurposeGenome editing for gene xylR (cbei-2385) in clostridium beijerinckii NCIMB 8052DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsCas9 nickase
sgRNA to xylR
UseE.coli - clostridium shuttle vectorMutationD10APromoterPj23119 and PthlAvailable sinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC2-A_sgBC2-C
Plasmid#154197PurposeLentiviral expression plasmid encoding two sgRNAs without a target. These can be used as a off-target control for CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC2-A, sgRNA-BC2-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available sinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNICKclos1.0
Plasmid#73639PurposeGenome editing for gene pyrE (CAC-002) in Clostridium acetobutylicum ATCC 824DepositorInsertsCas9 nickase
sGRNA to pyrE
UseE.coli-clostridium shuttle vectorMutationD10APromoterj23119 and ptbAvailable sinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330 _CRISPIE donor B7
Plasmid#172848PurposeDRS-2 sgRNA expression under a U6 promotor and CRISPIE donor B7 (Zhong et al, eLife 2021), mEGFP translational phase (0-0), excised by DRS-1 or DRS-2 sgRNA (with SpCas9).DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDRS-2 sgRNA and CRISPIE designer exon (phase 0-0) encoding mEGFP
UseCRISPRExpressionMammalianAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMS79 (eft-3p::Cas9 + sgRNA)
Plasmid#154839PurposeCas9 + sgRNA plasmid that is targeted to the synthetic guide sequence GGACAGTCCTGCCGAGGTGGDepositorInsertsgRNA
UseCRISPRExpressionWormAvailable sinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by