We narrowed to 12,964 results for: BASE
-
Plasmid#121806PurposepMVP L3-L2 entry plasmid, contains HA tag-polyA + EF1a-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds C-term HA tag to gene plus downstream EF1a-driven TETaDepositorInsertHA epitope tag-polyA + EF1a::TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTKan-p35S::Csy4-pNOS::cogRFP (C134, JBEI-15901)
Plasmid#110146PurposeTransformation and expression of Csy4 and cogDsRed proteins in plantsDepositorAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 HA-ECL3 (NT933)
Plasmid#49064PurposeExpresses human NKCC1 mutant with HA tag inserted into extracellular loop #3 and N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and mVenusExpressionMammalianMutation2xHA epitope in ECL3 inserted at aa460 in hNKCC1 …PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pORANGE C9orf4-GFP KI
Plasmid#131472PurposeEndogenous tagging of C9orf4: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti PA-NL
Plasmid#113453PurposeLentiviral ProteinA-NanoLuc hybrid fusion control expression vector (for BRET and LuC normalization)DepositorInsertProteinA-NanoLuc
UseLentiviral and LuciferaseExpressionMammalianPromoterhUbCAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCSIIneo-TRE-hPhyB621- mCherry-HRasCT
Plasmid#139482PurposeExpresses PhyB621-mCherry-HRasCT in mammalian cells.DepositorInsertPhyB621 (PHYB Mustard Weed)
UseLentiviralTagsmCherry-HRasCTExpressionMammalianMutationG229L and deletion of aa Y at position 235 in mch…PromoterTet responsible elementAvailable SinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTKan-p35S::Csy4-pNOS::cogGFP (C132, JBEI-15898)
Plasmid#110145PurposeTransformation and expression of Csy4 and cogGFP proteins in plantsDepositorAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
ROZA-XL YF
Plasmid#64195PurposeFluorescent reporter for ZAP-70 tyrosine kinase activity- Y to F mutated control sequenceDepositorInsertROZA-XL YF
ExpressionMammalianMutationROZA-XL tyrosine phosphorylation site mutated to …PromoterCMVAvailable SinceApril 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQ255-x3.7
Plasmid#124311PurposeGateway entry vector with rAPOBEC1 and pcoCas9D10A-x3.7 for C-T base editingDepositorInsertrAPOBEC1-pcoCas9D10A_x3.7-UGI
UseCRISPRAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ256-x3.7
Plasmid#124313PurposeGateway entry vector with PmCDA1 and pcoCas9D10A-x3.7 for C-T base editingDepositorInsertpcoCas9D10A_x3.7-PmCDA1-UGI
UseCRISPRAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS720a
Plasmid#87392PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1021b
Plasmid#87395PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1014a
Plasmid#87396PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQR-P2A-Puro
Plasmid#110848PurposeLentiviral vector for constitutive expression of Cas9-VQR (not codon optimized)DepositorInsertCas9-VQR
UseLentiviralTags3X FLAGMutationD1135V, R1335Q, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLN552 (FuGW-S(USF1)p-[GAD-Ex1]-[miR1-Mv3 intron]-[GAD-Ex2]-11Pe)
Plasmid#105202PurposeModule 1 - synthetic promoter USF1 drives self-inhibiting GAD expression (see PMID: 29056342 for detailed information)DepositorInsertS(USF1)p-[GAD-Ex1]-[miR1-Mv3 intron]-[GAD-Ex2]-11Pe
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 extracellular-cysteineless (NT864)
Plasmid#49069PurposeExpresses human NKCC1 mutant lacking extracellular cysteine residues and with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
Tags3x Flag and mVenusExpressionMammalianMutationC563S,C568S,C577S,C582S in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
LLP979
Plasmid#239901PurposeCaMV 35S-SynPro-14 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-14::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP955
Plasmid#239877PurposeTCTP-SynPro-08 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-08::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP956
Plasmid#239878PurposeTCTP-SynPro-09 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-09::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP957
Plasmid#239879PurposeTCTP-SynPro-10 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-10::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP958
Plasmid#239880PurposeTCTP-SynPro-11 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-11::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP953
Plasmid#239875PurposeTCTP-SynPro-06 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-06::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP954
Plasmid#239876PurposeTCTP-SynPro-07 engineered promoter driving the expression of Renilla luciferaseDepositorInsertTCTP-SynPro-07::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP967
Plasmid#239889PurposeCaMV 35S-SynPro-02 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-02::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP965
Plasmid#239887PurposeWild type CaMV 35S promoter engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP966
Plasmid#239888PurposeCaMV 35S-SynPro-01 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-01::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP968
Plasmid#239890PurposeCaMV 35S-SynPro-03 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-03::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP969
Plasmid#239891PurposeCaMV 35S-SynPro-04 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-04::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP970
Plasmid#239892PurposeCaMV 35S-SynPro-05 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-05::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP977
Plasmid#239899PurposeCaMV 35S-SynPro-12 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-12::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1017
Plasmid#239939PurposeCaMV 35S driving the expression of dCas9-ZAT10(1x)DepositorInsertCaMV 35S::dCas9-ZAT10(1x)
UseCRISPR and Synthetic BiologyMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP978
Plasmid#239900PurposeCaMV 35S-SynPro-13 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-13::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP980
Plasmid#239902PurposeCaMV 35S-SynPro-15 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-15::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1016
Plasmid#239938PurposeCaMV 35S driving the expression of dCas9-ZAT10(2x)DepositorInsertCaMV 35S::dCas9-ZAT10(2x)
UseCRISPR and Synthetic BiologyMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP975
Plasmid#239897PurposeCaMV 35S-SynPro-10 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-10::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP976
Plasmid#239898PurposeCaMV 35S-SynPro-11 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-11::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1023
Plasmid#239945PurposeCaMV 35S driving the expression of dCas9DepositorInsertCaMV 35S::dCas9
UseCRISPR and Synthetic BiologyMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP1024
Plasmid#239946PurposeCaMV 35S-SynPro-01 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-01::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLP971
Plasmid#239893PurposeCaMV 35S-SynPro-06 engineered promoter driving the expression of Renilla luciferaseDepositorInsertCaMV 35S-SynPro-06::Rluc
UseSynthetic BiologyTagsPEST on C-terminus of RlucMutationN/AAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only