We narrowed to 4,117 results for: SPL
-
Plasmid#148352PurposeBacterial Expression of CeMextli_471-507opt-I497DI504DDepositorInsertCeMextli_471-507opt-I497DI504D (Y18D10A.8 Nematode)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-NpM-CeMextli_471-507opt-M493D-GB1_AB
Plasmid#148353PurposeBacterial Expression of CeMextli_471-507opt-M493DDepositorInsertCeMextli_471-507opt-M493D (Y18D10A.8 Nematode)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-NpM-CeMextli_471-507opt-Y479AL484AM485A-GB1_AB
Plasmid#148354PurposeBacterial Expression of CeMextli_471-507opt-Y479AL484AM485ADepositorInsertCeMextli_471-507opt-Y479AL484AM485A (Y18D10A.8 Nematode)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
NODAL-matMYC-ex2trunc
Plasmid#115257PurposeFor mammalian expression of a C-terminal truncated human NODAL open reading frame with an internal MYC tagDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODALvar-MYC-DYK
Plasmid#115245PurposeFor mammalian expression of a human NODAL splice variant open reading frame with a C-terminal MYC-DYK tagDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDF11-SFPQ(214-535)
Plasmid#135439PurposeExpresses SFPQ 214-535 with TEV-cleavable hexahistidine tagDepositorInsertsplicing factor proline and glutamine rich (SFPQ Human)
TagsHexahistidineExpressionBacterialPromoterT7Available SinceMay 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHBS1506 [IBB-GFP-mCherry3E]-[BFP-TDP43 FYW-L]
Plasmid#133330PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationAll FYW to L in CTD of full-length TDP43Available SinceNov. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBS1507 [IBB-GFP-mCherry 3E]-[BFP-TDP43 VLIM-S]
Plasmid#133331PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationAll VLIM to S in CTD of full-length TDP43Available SinceNov. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHBS1508 [IBB-GFP-mCherry 3E]-[BFP-TDP43 VLIM-F]
Plasmid#133332PurposeTo test the effect of sequence on TDP43 splicing activityDepositorInsertTARDBP mutant (TARDBP Human)
ExpressionMammalianMutationAll VLIM to F in CTD of full-length TDP43Available SinceNov. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP-Caspase-1 (C285A) -NpLxIS
Plasmid#131354PurposeExpresses Caspase-1 C285A with 2 copies of pLxIS motif from STING fused to its N-ternimusDepositorInsertCaspase-1 (C285A)-NpLxIS (Casp1 Mouse)
UseRetroviralExpressionMammalianMutationCaspase-1 (C285A)Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR_Trf2
Plasmid#125159PurposeGateway entry cloneDepositorInsertTrf2 (Trf2 Fly)
UseGateway CloningAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2delta
Plasmid#124154PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1alpha
Plasmid#124147PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1beta
Plasmid#124148PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1gamma
Plasmid#124149PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2alpha
Plasmid#124151PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2beta
Plasmid#124152PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-2gamma
Plasmid#124153PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE (hygro) hYAP 1-1delta
Plasmid#124150PurposeProtein expression for funtional studies of cell growth promotionDepositorAvailable SinceApril 5, 2019AvailabilityAcademic Institutions and Nonprofits only