We narrowed to 14,669 results for: EGF
-
Plasmid#49865Purposefor Cre-lox cassette exchange of C-terminal yEGFP tagged gene sequences together with 6 copies of the core DSR motif into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxTagsyEGFPAvailable SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only
-
pAW8ENdeI-cyEGFP-3XDSR
Plasmid#49863Purposefor Cre-lox cassette exchange of C-terminal yEGFP tagged gene sequences together with 3 copies of the core DSR motif into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxTagsyEGFPAvailable SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAW8ENdeI-cyEGFP-8XDSR
Plasmid#49866Purposefor Cre-lox cassette exchange of C-terminal yEGFP tagged gene sequences together with 8 copies of the core DSR motif into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxTagsyEGFPAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAW8ENdeI-cyEGFP-4XDSR
Plasmid#49864Purposefor Cre-lox cassette exchange of C-terminal yEGFP tagged gene sequences together with 4 copies of the core DSR motif into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxTagsyEGFPAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
TV3-eGFP-dASUN
Plasmid#47033PurposeDrosophila testes specific expression of fluorescent dASUNDepositorAvailable SinceSept. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pQuantEGFP-hygro-kana
Plasmid#45588DepositorTypeEmpty backboneUseCre/Lox; Dt40 cell line targetingTagsQuant-EGFP tagAvailable SinceJuly 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCS2+CeGFP-ABCC9a
Plasmid#35581DepositorInsertABCC9a
UseSea urchin, zebrafish, xenopusTagseGFPExpressionMammalianPromoterSP6Available SinceJan. 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 hSlp4-a I18A
Plasmid#40043DepositorInserthSlp4-a I18A (SYTL4 Human)
TagsEGFPExpressionMammalianMutationIsoleucine 18 to AlaninePromoterCMV promoterAvailable SinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 hSlp4-a linker
Plasmid#40040DepositorInserthSlp4-a linker (SYTL4 Human)
TagsEGFPExpressionMammalianMutationlinker domain (144-353)PromotercmvAvailable SinceOct. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAG304GPD-EGFP-ccdB
Plasmid#14304DepositorTypeEmpty backboneUseGateway destinationTagsEGFPExpressionYeastAvailable SinceJune 18, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCLBW cox8 EGFP mCherry
Plasmid#78520PurposeFluorescent mitophagy reporterDepositorInsertnone
UseRetroviralTagscox8 EGFP mCherryExpressionMammalianPromoterCMVAvailable SinceJan. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N2-2XNLS-RNaseH1 delta 1-27 (WT)
Plasmid#196702PurposePlasmid for transient mammalian expression of wild type RNase H1 tagged with 2xNLS and EGFP that can be used to specifically degrade the nuclear R-loops.DepositorInserthuman RNaseH1 wild type
ExpressionMammalianAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-TRE-EGFP-EF1a-rtTA
Plasmid#104454PurposePiggyBac plasmid expressing EGFP under the control of a doxycycline-inducible promotorDepositorInsertsenhanced green fluorescent protein
reverse tetracycline-controlled transactivator 3
UsePiggybacExpressionMammalianAvailable SinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentipuro3/TO/V5-GW/EGFP-Firefly Luciferase
Plasmid#119816Purpose3rd generation lentiviral plasmid for expression of EGFP Firefly Luciferase fusion protein in mammalian cellsDepositorInsertsLuciferase
Puromycin
UseLentiviral and LuciferaseTagsEGFP and V5ExpressionMammalianMutationStop codon removed in the frame of the V5 frame v…PromoterCMV/TO and Human Phosphoglycerate kinaseAvailable SinceJan. 2, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDest eGFP MBNL1 42 kDa
Plasmid#61277PurposeMammalian expression of EGFP-tagged human MBNL1DepositorAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pXR001: EF1a-CasRx-2A-EGFP
Plasmid#109049PurposeCasRx (NLS-RfxCas13d-NLS) with 2A-EGFP for RNA targetingDepositorInsertCasRx
UseCRISPR and LentiviralTags2A-eGFP, HA, and NLSExpressionMammalianPromoterEF1AAvailable SinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/FRT/TO_CEP41-HaloTag7_T2A_EGFP
Plasmid#169327PurposeExpression of CEP41-HaloTag7 in mammalian cellsDepositorAvailable SinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-EGFP-KASH
Plasmid#209201PurposeNeuronal expression of EGFP tagged KASH protein domainDepositorInserteGFP-KASH
UseAAVTagsKASH localization domainExpressionMammalianPromoterhsynAvailable SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 gfaABC1D-Ezr-eGFP
Plasmid#176856PurposeExpresses Ezrin fused with eGFP at the C-terminus in astrocytesDepositorInsertEzr-GFP
UseAAVTagsGFPExpressionBacterialPromotergfaABC1DAvailable SinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only