We narrowed to 4,433 results for: chm
-
Plasmid#75243PurposeCRISPR/Cas9 NICKASE plasmid against human Ikaros (2/2)DepositorInsertsgRNA against human Ikaros (IKZF1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBabe-kappa-HA-dL5-myc-ADRB2
Plasmid#101253PurposeExpresses HA-dL5(E52D)-cMyc N-terminal fusion of beta-2 adrenergic receptor in mammalian cells, MMLV retroviral plasmid (MBIC5, dL5**, FAP, ADRB2)DepositorInsertkappa-HA-dL5-myc-ADRB2 (ADRB2 Human, Budding Yeast)
UseRetroviralTagsFAP-dL5 and HA epitopeExpressionMammalianPromoterMMLV LTRAvailable SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ikaros-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75242PurposeCRISPR/Cas9 NICKASE plasmid against human Ikaros (1/2)DepositorInsertsgRNA against human Ikaros (IKZF1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEAHISMRSA2028
Plasmid#97001PurposeExpressing MRSA Asp/Tyr/Phe pyridoxal-50- phosphate-dependent aminotransferaseDepositorInsertAsp/Tyr/Phe pyridoxal-50- phosphate-dependent aminotransferase
TagsN-ter TEV protease cleavable 6HisMutationnonePromoterT7Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLJC2-TOM20-HK2-3xFLAG
Plasmid#239245PurposeTOM20-HK2 lentiviral overexpression vectorDepositorUseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains the set of silent mutations descr…PromoterCMVAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLJC6-TOM20-HK2-3xFLAG
Plasmid#239256PurposeTOM20-HK2 lentiviral overexpression vectorDepositorUseLentiviralTags3xFLAGExpressionMammalianMutationInsert contains the set of silent mutations descr…PromoterUbcAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSGEM hKCNQ1
Plasmid#219952PurposeExpresses human KCNQ1 in Xenopus laevis oocytesDepositorInsertKCNQ1 (KCNQ1 Human)
UseXenopus laevis expressionMutationcontains silent sequence variationsAvailable SinceAug. 13, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCS2-MYC(Δ1-143)-GFP-IRES-mCherry (ΔTAD)
Plasmid#231233PurposeMYC stability reporter construct with deletion of the N-terminal region (residues 1-143) for transient expression in mammalian cellsDepositorInsertMYC (MYC Human)
ExpressionMammalianMutationTAD deleted (delta1-143); numbering based on sequ…Available SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-HA-MycΔdeg1∆deg2
Plasmid#231243PurposeHA-tagged MYC over-expession construct with point mutations corresponding to the deletion of degron 1 and 2 for transient expression in mammalian cellsDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
18065-M04-412
Plasmid#225667PurposeLentivirus protein expression. Control plasmid.DepositorInsertsUseLentiviralTags3xFLAGMutationC-terminally truncated (aa 1-333 only)PromoterWPRE-SV40p and mCMVpAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIG-748_HA-GD2-28z_CAR_BATF
Plasmid#207488PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertBATF, HA-GD2-28z_CAR (BATF Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-805_HA-GD2-28z_CAR_BATF-RFP
Plasmid#207492PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertBATF-RFP, HA-GD2-28z_CAR (BATF Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-755_HA-GD2-28z_CAR_RFP-JUN
Plasmid#207494PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertRFP-JUN, HA-GD2-28z_CAR (JUN Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-837_NY-ESO-1_TCR_tFAS
Plasmid#207500PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInserttFAS, NY-ESO-1_TCR (FAS Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCG_SARS-CoV1 C-V5-tag ORF7a
Plasmid#179971PurposeMammalian expression vector for SARS-CoV-1 ORF7a, V5-tagged. Sequence codon-optimized.DepositorInsertSARS-CoV-1 ORF7a (ORF7a Synthetic)
ExpressionMammalianAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCG_SARS-CoV1 NSP7 C-V5-tag
Plasmid#179963PurposeMammalian expression vector for SARS-CoV-1 Nsp7, V5-tagged. Sequence codon-optimized.DepositorAvailable SinceOct. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCG_batCoV RaTG13 ORF7a C-V5-tag
Plasmid#179989PurposeMammalian expression vector for RaTG13 ORF7a, V5-tagged. Sequence codon-optimized.DepositorInsertRaTG13 ORF7a
ExpressionMammalianMutationhuman codon-optimizedAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only