We narrowed to 1,496 results for: asl;
-
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLX302 OASL-V5 puro
Plasmid#158643PurposeLentiviral expression vector for constitutive expression of V5-tagged OASL.DepositorAvailable SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
dCas9-AsLOV2x3-NLSx3
Plasmid#231566PurposeExpresses components of the LOOMINA optogenetic transcriptional control system.DepositorInsertdCas9-AsLOV2x3
UseCRISPRExpressionMammalianAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-3xHA-mASL
Plasmid#34577PurposeNOTE: This plasmid contains 1xHA-mASL, not 3xHA-mASL.DepositorAvailable SinceDec. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pET28b-HRASLS3-1-132
Plasmid#100725PurposeExpression of N-terminal region of human HRASLS3 in E.coliDepositorAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-TASL-NEMO
Plasmid#221267PurposeExpression of TASL-NEMO IKK binding site in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TASL(FL)
Plasmid#221263PurposeExpression of TASL in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-TASL-PLPLR
Plasmid#221266PurposeExpression of TASL-STING PLPLR in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
CMV_dCas9-AsLOV2x3-NLSx3
Plasmid#231567PurposeExpresses components of the LOOMINA optogenetic transcriptional control system.DepositorInsertdCas9-AsLOV2x3
UseCRISPRExpressionMammalianAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphasL-RLuc8
Plasmid#140981PurposeEncodes a G alpha subunit (GNAS1) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphasL-RLuc8 (GNAS Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbS5c-mCherry-AsLOV2*(543)
Plasmid#202712PurposeExpresses an IPTG inducible mCherry fused to a blue light responsive degradation tag (LOVdeg)DepositorInsertmCherry-AsLOV2*(543)
ExpressionBacterialAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
1037 pGL3 FasL promoter
Plasmid#9028DepositorAvailable SinceDec. 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
CMV_Zdk3-VPR_P2A_dCas9-AsLOVx3-NLSx3
Plasmid#231568PurposeExpresses components of the LOOMINA optogenetic transcriptional control system.DepositorInsertAll-in-one LOOMINA construct
UseCRISPRExpressionMammalianAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TASL(pLxIS)
Plasmid#221261PurposeExpression of TASL pLxIS (266-298) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TASL(Cterm)
Plasmid#221262PurposeExpression of TASL Cterm (102-298) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBbA5k-AcrAB-AsLOV2*(543)
Plasmid#210863PurposeIPTG inducible promoter (lacUV5) expressing AcrA and AcrB-AsLOV2*(543). AsLOV2*(543) is also described in the literature as LOVdeg.DepositorInsertsacrA
acrB
UseSynthetic BiologyTagsAsLOV2*(543)Available SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
H2B-GFP-AsLOV2-NES27 (pDN158)
Plasmid#72659PurposeConstitutively nuclear variant of a very strong, photocaged NES (AsLOV2-NES 27) for blocking endogenous, CRM-1-dependent nuclear exportDepositorInsertH2B-GFP-AsLOV2-NES27
ExpressionMammalianPromoterCMVAvailable SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
H1_sgRNA(GRIN2B)_SauCas9_AcrIIA5-AsLOV2(N77)
Plasmid#246056PurposeExpression of a sgRNA targeting the GRIN2B locus, a SauCas9 and an AcrIIA5-cpGR2 hybrid (insertion before N77) linked through a P2A sequence, under the same pol-III H1 promoterDepositorInsertSauCas9, sgRNA(GRIN2B) and AcrIIA5_AsLOV2-N77
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
H1_sgRNA(GRIN2B)_SauCas9_AcrIIA5-AsLOV2(D41)
Plasmid#246055PurposeExpression of a sgRNA targeting the GRIN2B locus, a SauCas9 and an AcrIIA5-cpGR2 hybrid (insertion before D41) linked through a P2A sequence, under the same pol-III H1 promoterDepositorInsertSauCas9, sgRNA(GRIN2B) and AcrIIA5_AsLOV2-D41
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only