3,641 results
-
Plasmid#17585DepositorInserttaiman (tai Fly)
ExpressionInsectAvailable SinceNov. 10, 2008AvailabilityAcademic Institutions and Nonprofits only -
pBacPAK-HFT-dKDM4A
Plasmid#20233DepositorAvailable SinceMarch 17, 2009AvailabilityAcademic Institutions and Nonprofits only -
pBacPAK-HFT-dKDM4B
Plasmid#20234DepositorAvailable SinceMarch 17, 2009AvailabilityAcademic Institutions and Nonprofits only -
CJ23 (miR-1006 perfect site)
Plasmid#17763DepositorInsertmiR-1006 perfect site
UseLuciferase; Drosophila metallothionein gene promoā¦Tagsrenilla luciferaseExpressionInsectAvailable SinceApril 15, 2008AvailabilityAcademic Institutions and Nonprofits only -
CJ49 (cg11094 utr)
Plasmid#17777DepositorInsertcg11094 utr fragment
UseLuciferase; Drosophila metallothionein gene promoā¦Tagsrenilla luciferaseExpressionInsectAvailable SinceApril 15, 2008AvailabilityAcademic Institutions and Nonprofits only -
CG4845/pUAST-HA
Plasmid#17587DepositorAvailable SinceMarch 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
Stat92e pBluescript SK(+)
Plasmid#8712DepositorInsertStat92e (Stat92E Fly)
ExpressionBacterialAvailable SinceJuly 8, 2005AvailabilityAcademic Institutions and Nonprofits only -
pICH41258_Nslmb
Plasmid#232565PurposeLevel-0 module; NSlmbDepositorInsertNSlmb
UseCoding sequenceAvailable SinceMarch 31, 2026AvailabilityAcademic Institutions and Nonprofits only -
hsp70z.UPD2
Plasmid#252565PurposeDrosophila hsp70z basal promoter in UPD2 as a GoldenBraid basal promoter partDepositorInserthsp70z
UseCloningAvailable SinceMarch 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
y.Alpha2
Plasmid#252566PurposeDrosphila y+ gene in GoldenBraid Alpha2 vectorDepositorAvailable SinceMarch 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
CamKII-mito4x-GCaMP6f-Drosophila-Letm1
Plasmid#212663PurposeExpresses under a CamKII promoter: mito4x-GCaMP6f and Drosophila-Letm1DepositorAvailable SinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMT-FLAG-DmAgo1
Plasmid#229236PurposeExpresses FLAG-tagged Ago1 in Drosophila S2 cellsDepositorAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pUASTattBRhokinase-CIBN
Plasmid#244066Purposeactive kinase domain of Rok fused to the light sensitive dimerization domain CIBNDepositorInsertRhokinase-CIBN-HA
TagsHAExpressionInsectAvailable SinceNov. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT7R-7xsfGFP11-HA-HDR-donor
Plasmid#221818PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT7R coding frameDepositorInsert7xGFP11-HA donor with 5-HT7R homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT7R-sfGFP11-HA-CRISPR-HDR-donor
Plasmid#221819PurposeDonor plasmid for inserting GFP11-HA to the end of Drosophila 5-HT7R coding frameDepositorInsertGFP11-HA donor with homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT1AR-7xsfGFP11-HA-HDR-donor
Plasmid#221832PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT1AR coding frameDepositorInsert7xGFP11-HA donor with 5-HT1AR homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2BR-7xsfGFP11-HA-HDR-donor
Plasmid#221833PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2BR coding frameDepositorInsert7xGFP11-HA donor with 5-HT2BR homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_2xFlag-dSERT-HDR-donor-HDR
Plasmid#221835PurposeDonor plasmid for inserting 2xFLAG at the beginning of Drosophila SERT coding frameDepositorInsert2xFLAG with dSERT homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT1BR-7xsfGFP11-HA-HDR-donor
Plasmid#221837PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT1BR coding frameDepositorInsert7xGFP11-HA donor with 5-HT1BR homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2AR(isoformD)-7xsfGFP11-HA-HDR-donor
Plasmid#221838PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsert7xGFP11-HA donor with 5-HT2AR (isoform D) homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2AR(isoformBFH)-7xsfGFP11-HA-HDR-donor
Plasmid#221839PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsert7xGFP11-HA donor with 5-HT2AR (isoforms BFH) homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT2BR-7xGFP11-HA
Plasmid#221840PurposePlasmid for generating 10xUAS-5-HT2BR-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUAS-spatzle-HA
Plasmid#240235PurposeExpression of spatzle-HA under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUAS-hhN-HA
Plasmid#240236PurposeExpression of hhN-HA under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorInserthedgehog N-terminal fragment (hh Fly)
TagsHA-spGFP11ExpressionInsectMutationaa 1-257PromoterUASAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUAS-CG6867-sfGFP
Plasmid#240237PurposeExpression of CG6867-sfGFP under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR_CG6867_nostop
Plasmid#240238PurposeGateway entry clone with CG6867 without stop codonDepositorInsertCG6867 (CG6867 Fly)
UseGateway shuttle vectorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR_hhN-HA
Plasmid#240225PurposeGateway entry clone with N-terminal hedgehog (hhN) tagged with HA (contains stop codon)DepositorInserthedgehog N-terminal fragment (hh Fly)
UseGateway shuttle vectorTagsHA-spGFP11Mutationaa 1-257Available SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR_spatzle-HA
Plasmid#240227PurposeGateway entry clone with spatzle tagged with HA (contains stop codon)DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUASTattB-cytoFLARE1.0-TF
Plasmid#234521PurposeTranscriptional reporter for detecting calcium transients in Drosophila larvae (transcription factor)DepositorInsertERT2-MK2-hLOV-TEVcs-FLAG-LexA-VP16
ExpressionInsectAvailable SinceMay 1, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUASTattB-cytoFLARE1.0-TEV
Plasmid#234519PurposeTranscriptional reporter for detecting calcium transients in Drosophila larvae (TEVp)DepositorInsertCaM-V5-TEVp
ExpressionInsectAvailable SinceMay 1, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAG426-GAL-SoxN-A22-EGFP
Plasmid#181731PurposeGalactose inducible expression of SoxN-A22-EGFPDepositorInsertSoxN-A22-EGFP (SoxN Fly)
Tags3xFLAG-EGFPExpressionYeastMutationextended repeat of 22 Ala residues replacing natiā¦Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTub-split-intein-Gal4[1-20]-N-int
Plasmid#199210PurposeFor ubiquitous expression of split-intein Gal4-N-int component under control of the tubulin promoterDepositorInsertsplit-intein Gal4[1-20]-N-int
Available SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTub-split-intein-Gal4[21-881]-C-int
Plasmid#199211PurposeFor ubiquitous expression of split-intein Gal4-C-int component under control of the tubulin promoterDepositorInsertsplit-intein-Gal4[21-881]-C-int
Available SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSN539
Plasmid#226775PurposeExpresses Drosophila UNC-104(wild-type) in insect cellsDepositorAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKC51
Plasmid#226779PurposeExpresses Drosophila UNC-104(A255V) in insect cellsDepositorInsertDrosophila unc-104 (A255V) (unc-104 Fly)
TagssfGFP and 2xStrepIIExpressionInsectMutationchanged Alanine 255 to ValineAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-PH-mCherry-MARF1 isoform D (HK56)
Plasmid#206470PurposeMARF1 expression in Schneider cells for imagingDepositorAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-NOT1 isoform C-mCherry-PH (EB5)
Plasmid#206474PurposeNOT1 expression in Schneider cells for imagingDepositorAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only