We narrowed to 10,141 results for: tre promoter
-
Plasmid#196091PurposeExpresses mouse SAFB lacking the n-terminal SAP domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
TagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 31-65 (SAP domain) of mouse S…PromoterCAGGSAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-safb∆rrm-NLS-3XFLAG-V5
Plasmid#196093PurposeExpresses mouse SAFB lacking the rrm domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
TagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 428-506 (RRM) of mouse SAFB p…PromoterCAGGSAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CAG-NOTCH2NL-delta C terminus (N2NL-delta C)-ires-mCherry
Plasmid#122959PurposeLentiviral expression of NOTCH2NL delta C terminus under CAG promoter with mCherry expressionDepositorInsertNOTCH2NL-delta C terminus (NOTCH2NLB Human)
UseLentiviralTags6xmyc tagMutationdeletion of C terminus from full length NOTCH2NLBPromoterCAG promoterAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CAG-NOTCH2NL-delta C terminus (N2NL-delta C)-ires-EGFP
Plasmid#122956PurposeLentiviral expression of NOTCH2NL delta C terminus under CAG promoter with EGFP expressionDepositorInsertNOTCH2NL-delta C terminus (NOTCH2NLB Human)
UseLentiviralTags6xhis tagMutationdeletion of C terminus from full length NOTCH2NLBPromoterCAG promoterAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-safb∆dd1-NLS-3XFLAG-V5
Plasmid#196092PurposeExpresses mouse SAFB lacking the first computationally called disordered domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
TagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 96-285 (predicted disordered …PromoterCAGGSAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-safb∆dd3-NLS-3XFLAG-V5
Plasmid#196094PurposeExpresses mouse SAFB lacking the third computationally called disordered domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
TagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 638-925 (predicted disordered…PromoterCAGGSAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-SAFB-DD3-NLS-3XFLAG-V5
Plasmid#196095PurposeExpresses only the third computationally called disordered domain of mouse SAFB in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
TagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationContains only AA 619-925 (NLS and predicted disor…PromoterCAGGSAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CAG-NOTCH2NL-delta EGF repeats (N2NL-delta EGF)-ires-EGFP
Plasmid#122955PurposeLentiviral expression of NOTCH2NL delta EGF repeats under CAG promoter with EGFP expressionDepositorInsertNOTCH2NL-delta EGF repeats (NOTCH2NLB Human)
UseLentiviralTags6xhis tagMutationdeletion of EGF repeats from full length NOTCH2NLBPromoterCAG promoterAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-PtenWT-Puro
Plasmid#135676PurposeConstitutive expression (cMV promoter) of wildtype Pten cDNA, Puromycin selectionDepositorInsertPten (Pten Mouse)
UseLentiviralAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
TYK2A-c075
Plasmid#53688PurposeBaculovirus expression for structure determination; may not be full ORFDepositorAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pACYCduet-mxLOX2-EH
Plasmid#104979PurposeBiosynthesis of oxylipins by microbial enzymesDepositorExpressionBacterialPromoterT7 promoterAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
CAG-ABEmax-P2A-EGFP-ires-puro
Plasmid#121170PurposeCAG promoter driven expression of ABEmax base editor, EGFP and Puromycin resistance.DepositorInsertABEmax-P2A-EGFP-ires-puro
UseCRISPRTagsP2A-EGFP-ires-puroExpressionMammalianAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
CAG-FNLS-T2A-EGFP-ires-puro
Plasmid#121169PurposeCAG promoter driven expression of FNLS BE3 base editor, EGFP and Puromycin resistance.DepositorInsertFNLS-T2A-EGFP-ires-puro
UseCRISPRTagsT2A-EGFP-ires-puroExpressionMammalianAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
CAG-xFNLS-T2A-EGFP-ires-puro
Plasmid#121171PurposeCAG promoter driven expression of xFNLS BE3 base editor, EGFP and Puromycin resistance.DepositorInsertxFNLS-T2A-EGFP-ires-puro
UseCRISPRTagsT2A-EGFP-ires-puroExpressionMammalianAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX458-tRNA-SpCas9
Plasmid#195183PurposeVector for transient Cas9 and EGFP expression. Small tRNA promoter for sgRNA cloning by GoldenGate.DepositorInsertCas9
UseCRISPRPromotertRNA-GlnAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
p5E-elavl3
Plasmid#72640PurposeGateway p5E 5'entry clone with elavl3 (HuC) enhancer/promoter for pan-neuronal expression in zebrafishDepositorInsertelavl3 enhancer (elavl3 Zebrafish)
Available SinceApril 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
JDS246
Plasmid#43861PurposeExpresses mammalian codon optimized Cas9 nuclease with C-term 3X FLAG from CMV and T7 promotersDepositorInsertmammalian codon-optimized streptococcus pyogenes Cas9 - 3X Flag
UseCRISPRTags3X FLAGExpressionMammalianPromoterCMVAvailable SinceMarch 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTwist-Kan-MC-L0-TaBSS2-5PU
Plasmid#242009PurposeL0 Pro+5U Golden Gate part for 5' UTR, core promoter, and upstream regulatory regions of Triticum aestivum TraesCS2B02G399800DepositorInsertTaBSS2-5PU
UseSynthetic BiologyExpressionPlantAvailable SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only