We narrowed to 14,123 results for: cas9
-
Plasmid#196254PurposePlasmid for cloning the third CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag2-gRNA2
Plasmid#196252PurposePlasmid for cloning the second CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag1-gRNA1
Plasmid#196251PurposePlasmid for cloning the first CRISPR-Cas9 guide RNA of multiplex guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTL-Bag4-gRNA4
Plasmid#196255PurposePlasmid for cloning the 4th CRISPR-Cas9 guide RNA of 4 guide RNAsDepositorInsertCRISPR-Cas9 guide RNA scaffold and multiple cloning site
ExpressionBacterialPromoterJ23119 promoterAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSC43
Plasmid#104817PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-1). Also expresses Cas9 from Gmubi promoter from rolD promoterDepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC44
Plasmid#104818PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-1). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-VPR
Plasmid#68498Purposenuclease competent ST1-Cas9 fused to VPRDepositorInsertST-Cas9-VPR
TagsVPRExpressionMammalianPromoterCMVAvailable SinceSept. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
SpRY-IP
Plasmid#235994PurposeExpresses Cas9-SpRY in mammalian cellsDepositorInsertSpRY
UseCRISPRExpressionMammalianPromoterEF-1aAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 EGFP sgRNA4
Plasmid#164934PurposeExpresses EGFP sgRNA4 in mammalian cellsDepositorInsertsgRNA4 targeting Enhanced green fluorescent protein (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 NT sgRNA5
Plasmid#164930PurposeExpresses Non-targeting sgRNA5 control in mammalian cellsDepositorInsertNon-targeting sgRNA5 (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’eGFP/sgVIM
Plasmid#170548PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of VIM
UseCRISPR and LentiviralPromoterU6Available SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTW037
Plasmid#185688PurposeT-DNA for creating transgenic plants expressing Cas9 and Drm1b gRNAsDepositorInsertCas9, Drm1b gRNA
UseCRISPRExpressionPlantAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV495
Plasmid#177702PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAaGCAGATTAAtGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SRC1p (Debaryomyc…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSC45
Plasmid#104819PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-2). Also expresses Cas9 from Gmubi promoter.DepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC29
Plasmid#104803PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr4g094545 (Hen1). Also expresses Cas9 from Gmubi promoter.DepositorInsertMedtr4g094545
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28b-SpRY-His
Plasmid#179320PurposePlasmid for bacterial expression and purification of SpRY-Cas9DepositorInsertHuman codon-optimized Cas9 variant SpRY
UseCRISPRTags6xHis and SV40-NLSExpressionBacterialMutationSpRY=A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/ N13…Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28b-SpG-His
Plasmid#179318PurposePlasmid for bacterial expression and purification of SpG-Cas9DepositorInsertHuman codon-optimized Cas9 variant SpG
UseCRISPRTags6xHis and SV40-NLSExpressionBacterialMutationSpG=D1135L/S1136W/G1218K/E1219Q/ R1335Q/T1337RAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
-