We narrowed to 14,534 results for: egf
-
Plasmid#12981DepositorInsertRac1 constitutively active (RAC1 Human)
TagsEGFPExpressionMammalianMutationQ61L Constitutively activeAvailable SinceOct. 27, 2006AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-SFFV-EGFP-NLS
Plasmid#86677PurposeExpresses nuclear-localized GFP after lentiviral transduction. Can be used to monitor GFP leakage into the cytosol following nuclear envelope rupture events.DepositorInsertEGFP-NLS
UseLentiviralAvailable SinceApril 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HDR-mEGFP-camk2a
Plasmid#104589PurposeAAV vector including gRNA expression cassette and mEGFP knock-in donor targeting mouse camk2aDepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Mouse)
UseAAV, CRISPR, and Mouse TargetingPromoterNoneAvailable SinceDec. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pICE-EGFP-FLAG-PSMD2
Plasmid#161917PurposeExpresses human PSMD2 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.DepositorInsert26S proteasome non-ATPase regulatory subunit 2 (PSMD2 Human)
TagsGFP-FLAGExpressionMammalianPromoterCMVAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV Ef1a-EGFP-WPRE
Plasmid#135428PurposeCan be used to express EGFP. Can also be used to create adeno-associated virus for delivery of the EGFP sequenceDepositorInsertEGFP
UseAAVExpressionMammalianPromoterEF1aAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pICE-EGFP-FLAG-PLIN3
Plasmid#161918PurposeExpresses human PLIN3 with a N-terminal GFP-FLAG tag. Confers Puromycin resistance. Inducible in T-REx cells.DepositorAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLVX-RNaseHI-NES-EGFP
Plasmid#196701PurposePlasmid for stable expression of wild type bacterial RNase HI tagged with NES and EGFP that can be used to specifically degrade the DNA-RNA hybrids in the cytoplasm.DepositorInsertbacterial RNaseHI
UseLentiviralAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
IRE1-2EGFP-ter-kanMX4
Plasmid#184766PurposeIntegration of 2xGFP tag at IRE1 C terminus. Potential indicator of UPR activation. Uses antibiotic resistance marker kanMX4.DepositorAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-CMV-EGFP-Hygro
Plasmid#184593PurposeEGFPDepositorInsertEGFP
UseLentiviralPromoterCMVAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPyCAG-EGFP-TM-IRES-Pac
Plasmid#183603PurposeMammalian expression vector for membrane-tethered EGFP from the CAG promoter. Confers puromycin resistance.DepositorInsertEGFP-TM
TagsHuman PDGFRB transmembrane domain and Mouse IgGK …ExpressionMammalianPromoterCAGAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-eGFP-PC1-3HA
Plasmid#108406PurposeCan be used to generate stable Flp-In cells with tetracycline-inducible human PC1 expression.DepositorAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-dCas9-dMQ1-EGFP
Plasmid#89637PurposeTargeted CpG methylationDepositorInsertsite-specific DNA-methyltransferase SssI
UseCRISPRTags3*FLAG, 6*His, and T2A-EGFPExpressionMammalianMutationC141S, TGC-->TCC; S317A, AGC-->GCCPromoterCMVAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-hygro-eGFP-HEC1
Plasmid#114027PurposeInducible expression of eGFP-tagged HEC1 in FLPin Trex cell linesDepositorInserteGFP-HEC1 - Wildtype (NDC80) (NDC80 Human)
ExpressionMammalianAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBabe EGFR(L858R/T790M)
Plasmid#32073DepositorAvailable SinceSept. 19, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo FlucDM EGFP
Plasmid#90172PurposeEGFP-tagged constructs to monitor the aggregation state of the sensors and the ability of cells to solubilize or degrade the aggregated proteins. FLuc contains double mutationDepositorInsertFLuc EGFP
ExpressionMammalianMutationR188Q, R261Q in FLucAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pTH-iCre:EGFP-WPREpA
Plasmid#213142PurposeTruncated rat TH promoter expressing iCre fused to EGFPDepositorInsertiCre
UseAAVTagsEGFPExpressionMammalianPromoterTruncated TH promoter from rat (Rattus norvegicus…Available SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCALPS-Flag-Miwi-EGFP
Plasmid#212575PurposeLentiviral expression of Flag-tagged mouse Miwi in mammalian cellsDepositorInsertMiwi (Piwil1 Mouse)
UseLentiviralTags5x Flag and SNAP tagExpressionMammalianPromoterSFFVAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
LncRNA overexpression EF1α_BbsI_SV40 polyA_EGFP
Plasmid#219828PurposeOverexpression vector for non-coding RNAs driven by EF1α promoter with GFP. Cloning using BbsI.DepositorTypeEmpty backboneExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
IRE1 alpha-pcDNA3.EGFP
Plasmid#13009DepositorInsertInositol Requiring Enzyme-1 (ERN1 Human)
ExpressionMammalianAvailable SinceNov. 27, 2006AvailabilityAcademic Institutions and Nonprofits only