We narrowed to 23,913 results for: promoter
-
Plasmid#233824PurposeMoClo-YTK; type3A; Activation domains; NLS-VP48DepositorInsertNLS-VP48
ExpressionYeastAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME_Cp_0_2_003_psaA2_prom_Cr
Plasmid#235811PurposepsaA2 promoter Chlamydomonas reinhardtiiDepositorInsertpsaA2 promoter
UseSynthetic BiologyMutationnoneAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAP-U2-3
Plasmid#236474PurposePlasmid for integration at the native URA3 locus with 3xmCherry under control of the ScACT1 promoter and 3xGFP under control of the ApACT1 promoter.DepositorInsertscACT1p-3xmCherry apACT1p-3xGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAP-U2-4
Plasmid#236475PurposePlasmid for integration at the native URA3 locus with 3xmCherry under control of the ScACT1 promoter and 3xGFP under control of the ApTUB1 promoter.DepositorInsertscACT1p-3xmCherry apTUB1p-3xGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAP-U2-2
Plasmid#236473PurposePlasmid for integration at the native URA3 locus with 3xmCherry under control of the SpH2B promoter and 3xGFP under control of the ScACT1 promoter.DepositorInsertspH2Bp-3xmCherry scACT1p-3xGFP
ExpressionYeastMutationCodon optimized for A. pullulansAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-TO-g0 (FLP-IN)
Plasmid#236120PurposePlasmid encoding g0 guide RNA under control of CMV promoter with two TetR binding sites, used to equalize plasmid masses for transfectionDepositorInsertg0
ExpressionMammalianPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW434 4x(ZNF35/ZNF35tar)-SFFV-GFP
Plasmid#236143PurposeFluorescent reporter encoding GFP under control of SFFV promoter with four ZNF35/ZNF35 binding sites upstreamDepositorInsertEGFP
ExpressionMammalianPromoterSFFV promoter with four ZNF35/ZNF35 binding sites…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW435 4x(ZNF35/IKZF1tar)-SFFV-GFP
Plasmid#236144PurposeFluorescent reporter encoding GFP under control of SFFV promoter with four ZNF35/IKZF1 binding sites upstreamDepositorInsertEGFP
ExpressionMammalianPromoterSFFV promoter with four ZNF35/IKZF1 binding sites…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW420 4x(ZNF35/ZNF250tarv3)-SFFV-GFP
Plasmid#236139PurposeFluorescent reporter encoding GFP under control of SFFV promoter with four ZNF35/ZNF250 binding sites upstreamDepositorInsertEGFP
ExpressionMammalianPromoterSFFV promoter with four ZNF35/ZNF250 binding site…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGYL17_pPromALB_enhALB_FireflyLuc
Plasmid#220283PurposeFirefly luciferase with minimal Albumin promoter with a 380 nt, -10.5 kb mouse Alb enhancer cloned into KpnI/XhoI-digested pPromALB_FireflyLucDepositorInsertAlb Enhancer
UseLuciferasePromoterminimal albumin promoterAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGYL18_pPromALB_enhALB_RenillaLuc
Plasmid#220284PurposeRenilla luciferase with minimal Albumin promoter with a 380 nt, -10.5 kb mouse Alb enhancer cloned into KpnI/XhoI-digested pGL4.70 (Promega)DepositorInsertAlb Enhancer
UseLuciferasePromoterminimal albumin promoterAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSJ107-2x
Plasmid#208812PurposeExpresses SoxS activation domainand gRNA targeting two copies of 107 region within the synthetic promoter in bacterial cellDepositorInsertsgRNA 107-2x_mRFP
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterCRISPR/dCas9-responsive synthetic promoterAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSJ106-2x
Plasmid#208860PurposeExpresses SoxS activation domain and gRNA targeting two copies of 106 region within the synthetic promoter in bacterial cellDepositorInsertsgRNA 106-2x_mRFP
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterCRISPR/dCas9-responsive synthetic promoterAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpyA-GFP
Plasmid#220189PurposesgRNA expression vector - pEM7 promoter with GFP in sgRNA siteDepositorInsertpEM7 promoter with GFP in sgRNA site
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpEM7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpyD-GFP
Plasmid#220192PurposesgRNA expression vector - pBG28 promoter with GFP in sgRNA siteDepositorInsertpBG28 promoter with GFP in sgRNA site
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpBG28Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-GST-EGFP-GPIDAF
Plasmid#213716PurposeFor lentiviral expression of shRNA under a U6 promoter, accompanied by the expression of the affinity sorting tag GST-EGFP-GPIDAF driven by an hPGK promoter.DepositorInsertEGFP
TagsGSTExpressionMammalianPromoterhPGKAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-GST-EGFP-GPIBY55
Plasmid#213717PurposeFor lentiviral expression of shRNA under a U6 promoter, accompanied by the expression of the affinity sorting tag GST-EGFP-GPIBY55 driven by an hPGK promoter.DepositorInsertEGFP
TagsGSTExpressionMammalianPromoterhPGKAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-GST-EGFP-GPICEAM7
Plasmid#213718PurposeFor lentiviral expression of shRNA under a U6 promoter, accompanied by the expression of the affinity sorting tag GST-EGFP-GPICEAM7 driven by an hPGK promoter.DepositorInsertEGFP
TagsGSTExpressionMammalianPromoterhPGKAvailable SinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2pA ins:TDimer mVenus
Plasmid#210520PurposeExpresses a tandem dimer of mVenus in zebrafish pancreatic beta cells using a zebrafish insulin promoterDepositorInsertTandem dimer mVenus
UseZebrafish expression, tol2 kit gateway-compatiblePromoterZebrafish insulin promoterAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only