We narrowed to 16,985 results for: She
-
Plasmid#86658PurposeLuciferase reporter containing CDK4 promoterDepositorInsertCDK4 promoter (CDK4 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationgenerated by cleavage at the NcoI site from 880 (…PromoterCDK6Available sinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSicoR (Puro) NEMO shRNA2
Plasmid#22506DepositorInsertNEMO shRNA2 (Ikbkg Mouse)
UseCre/Lox, Lentiviral, and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceDec. 10, 2009AvailabilityAcademic Institutions and Nonprofits only -
mCardinal-Cx43-7
Plasmid#56157PurposeLocalization: Gap Junctions, Excitation: 604, Emission: 659DepositorInsertCx43
UseTagsmCardinalExpressionMammalianMutationPromoterCMVAvailable sinceMarch 4, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoBRET Assay Vector, NanoLuc-KRAS WT
Plasmid#236878PurposeExpress NanoLuc(R)-KRAS WT in Mammalian Cells under a CMV promoterDepositorUseTagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable sinceSept. 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
PB_Mut(D1399Y)_p300_core-dCas9-EGFP_hygro
Plasmid#226427PurposePiggyBac transposon vector containing a dox inducible mutant p300 core-dCas9 fusion protein (p300 core mutation: D1399Y) and EGFP reporter. Hygromycin selection marker.DepositorInsertsMutant p300 core-dCas9-EGFP fusion protein
rtTA3-IRES-Hygro
UseCRISPR and Synthetic Biology; Piggybac transposonTagsHA tag, Mutant p300 core, and P2A-EGFPExpressionMammalianMutationp300 core mutation (D1399Y)PromoterDox inducible minimal CMV and UbC PromoterAvailable sinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-mScarlet-3H (JDW 1513)
Plasmid#242551PurposeGateway middle entry clone containing H2B-mScarlet-3H; Nuclear red fluorescent reporterDepositorInsertmScarlet3-H
UseGateway subcloningTagsExpressionMutationPromoterAvailable sinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT7-7 a-syn A53T D115A mNeonGreen-3K-B11
Plasmid#232017PurposeBacterial expression of alpha synuclein A53T mutant, tagged with the final beta strand of mNeonGreen-3KDepositorInsertSNCA (SNCA Human)
UseTagsmNeonGreen-3K beta11ExpressionBacterialMutationAla53Thr Asp115AlaPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV mTagBFP2-2A-CHMP2B
Plasmid#232000PurposeBicistronic expression of CHMP2B along with an mTagBFP2 transfection marker, connected via 2A sequences.DepositorInsertCHMP2B (CHMP2B Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV mTagBFP2-2A-CHMP2B-Q165X
Plasmid#232001PurposeBicistronic expression of CHMP2B Q165X mutant along with an mTagBFP2 transfection marker, connected via 2A sequences.DepositorInsertCHMP2B (CHMP2B Human)
UseTagsExpressionMammalianMutationQ165XPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV CHMP2B-L4D F5D-3XHA
Plasmid#232003PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with a 3xHA tag.DepositorInsertCHMP2B (CHMP2B Human)
UseTags3xHAExpressionMammalianMutationL4D F5DPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1a FLAG-CHMP2B-d55-96
Plasmid#232013PurposeExpression of FLAG-tagged CHMP2B with the second alpha helix deleted.DepositorInsertCHMP2B (CHMP2B Human)
UseLentiviralTagsFLAGExpressionMammalianMutationΔ55-96PromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorInsertCHMP2B-targeted sgRNA (CHMP2B Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SNCA-A53T-mClover3
Plasmid#215378PurposeExpression of the A53T mutant of alpha-synuclein with a C-terminal mClover3 tag.DepositorInsertSNCA (SNCA Human)
UseTagsmClover3 tagExpressionMammalianMutationAla53ThrPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SNCA-A53T-mRuby3
Plasmid#215379PurposeExpression of the A53T mutant of alpha-synuclein with a C-terminal mRuby3 tag.DepositorInsertSNCA (SNCA Human)
UseTagsmRuby3 tagExpressionMammalianMutationAla53ThrPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCR197
Plasmid#240643PurposeExpression of the tri-cistronic construct NES-AmNeonGreen-P2A-mTurquoise2-NLS-T2A-mScarlet-I-PTS1 in Exaiptasia diaphana; In vitro transcription of the same construct via SP6 polymeraseDepositorInsertsAIPGENE865 promoter
SP6 promoter
AmNeonGreen
mTurquoise2
mScarlet-I
UseGene expression and genomic integration in fishTagsNES (from Exaiptasia diaphana MEK2), NLS (from SV…ExpressionMutationCodon-optimized for Exaiptasia diaphana, amino ac…PromoterAvailable sinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CMV-RFP-p2A-DAAO-NES
Plasmid#238920PurposeExpression of DAAO with a nuclear export signal and RFP as a reporter in mammalian cellsDepositorInsertRFP-p2A-DAAO-NES
UseAAVTagsExpressionMammalianMutationPromoterCMVAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-2x-lns-DEST (JDW 1206)
Plasmid#229818PurposeA PiggyBac destination vector compatible with gateway with 2 core cHS4 insulators by each ITR siteDepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-SV40
Plasmid#226453PurposeFor subcloning of SV40 promoter or for assays using M13 phageDepositorInsertSV40
UseCloning vectorTagsExpressionMutationNoPromoterAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP(N55D)-CNOT7-V5H6.MCh.Puro
Plasmid#209949PurposeIn mammalian cells expresses non-binding TP mutant fused to a CNOT7 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) with a N55D mutation that i…ExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-(inactive)CNOT7-V5H6.MCh.Puro
Plasmid#209936PurposeIn mammalian cells expresses TP fused to an inactive CNOT7 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsEnzymatically inactive CCR4-NOT transcription complex subunit 7 (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusCNOT6interaction)-V5H6.MCh.Puro
Plasmid#209940PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with CNOT6 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with CNOT6) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusCNOT6NOT1interaction)-V5H6.MCh.Puro
Plasmid#209941PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with CNOT6 or NOT1 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with NOT1 and CNOT6) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusNOT1interaction)-V5H6.MCh.Puro
Plasmid#209942PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with NOT1 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with NOT1) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-flag-IARS2-Δ1-48
Plasmid#232341PurposeExpresses human IARS2 with mito-location signal replaced by flag tag in mammalian cells, also carrying synonymous mutations described in Addgene #232340DepositorInsertIARS2 (IARS2 Human)
UseTagsExpressionMammalianMutationResidues 1-48 (indicated as Mito-signal in UniPro…PromoterCMVAvailable sinceJune 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-miR30-shJAG1 #1
Plasmid#171196PurposeRetroviral vector for U6 promoter driven expression empty miR30 based shJAG1 #1 (to be used in conjunction with Phoenix packaging cells).DepositorInsertshJAG1 #1
UseRetroviralTagsExpressionMammalianMutationPromoterU6Available sinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-miR30-shJAG1 #4
Plasmid#171197PurposeRetroviral vector for U6 promoter driven expression empty miR30 based shJAG1 #4 (to be used in conjunction with Phoenix packaging cells).DepositorInsertshJAG1 #4
UseRetroviralTagsExpressionMammalianMutationPromoterU6Available sinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
UBQ10pro-nlsABACUS2-400n-NosT
Plasmid#203728PurposeBinary vector for the transformation of the nlsABACUS2-400n biosensor for (+)-Abscisic acid into ArabidopsisDepositorInsertnlsABACUS2-400n
UseSynthetic BiologyTagsMycExpressionPlantMutationPromoterAtUBQ10pro 1500bpAvailable sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA_052_HygroR
Plasmid#228937PurposePlasmid for cloning of custom gRNA using EnAsCas12aDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_N-myc
Plasmid#234045PurposeBacterial expression of N-terminally 6His-tagged N-myc; includes TEV cleavage siteDepositorInsertN-myc (MYCN Human)
UseTags6xHisExpressionBacterialMutationPromoterT7Available sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-mNgn2-x3HA
Plasmid#233189PurposeRetroviral expression of tagged mNgn2x3HADepositorInsertmNgn2 (Neurog2 Mouse)
UseRetroviralTagsx3HAExpressionMammalianMutationPromoterAvailable sinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-mNgn2-x3FLAG
Plasmid#233190PurposeRetroviral expression of tagged mNgn2x3FLAGDepositorInsertmNgn2 (Neurog2 Mouse)
UseRetroviralTagsx3FLAGExpressionMammalianMutationPromoterAvailable sinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-mNgn2-x1HA
Plasmid#233191PurposeRetroviral expression of tagged mNgn2x1HADepositorInsertmNgn2 (Neurog2 Mouse)
UseRetroviralTagsx1HAExpressionMammalianMutationPromoterAvailable sinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-mNgn2
Plasmid#233148PurposeRetroviral expression of Ngn2DepositorInsertNgn2 (Neurog2 Mouse)
UseRetroviralTagsExpressionMammalianMutationPromoterAvailable sinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pMXs-mLhx3
Plasmid#233150PurposeRetroviral expression of Lhx3DepositorInsertLhx3 (Lhx3 Mouse)
UseRetroviralTagsExpressionMammalianMutationPromoterAvailable sinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-Puro-DEST (JDW 925)
Plasmid#229808PurposeA puromycin selectable, PiggyBac destination vector compatible with 4-way multi-site gateway cloning systemDepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGLAST-DEST (JDW 1009)
Plasmid#229822PurposeA single site gateway compatible destination vector with an upstream GLAST promotor to drive expression in glial cells.DepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-Neo-DEST (JDW 940)
Plasmid#229825PurposeA neo selectable, PiggyBac destination vector compatible with gateway cloning system.DepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBeta-MHC-promoter DV (JDW 26)
Plasmid#229835PurposeA gateway compatible destination vector containing the murine beta-MHC promoter for embryonic and postnatal cardiomyocyte expression.DepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXMLC2-DEST (JDW 7)
Plasmid#229833PurposeA gateway compatible destination vector containing the Xenopous myosin light chain 2 promoter for embryonic and adult cardiomyocyte expression.DepositorTypeEmpty backboneUseGateway destination vectorTagsExpressionMutationPromoterAvailable sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-MCS (JDW 455)
Plasmid#229832PurposeA gateway compatible middle entry clone containing an MCS (mutiple cloning site).DepositorInsertattL1/L2 flanked MCS
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-DV-IRES-myr-BFP (JDW 491)
Plasmid#229834PurposeA CAGGS driven gateway compatible destination vector that contains an IRES-myristoylated-TagBFP for labeling the cell membraneDepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-phiC31o (JDW 453)
Plasmid#229842PurposeA CMV-driven Phi31 recombinase.DepositorInsertphiC31 codon optimized, PhiC31o
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-StayGoldc4-Giantin (JDW 1355)
Plasmid#229844PurposeA gateway compatible middle entry clone containing a V5 tagged n2StayGoldc4 flourescent proteinDepositorInsertn2StayGoldc4
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRII-dgat2 in situ probe
Plasmid#232134Purposezebrafish dgat2 anti-sense in situ probe, linearize with BamHI, T7 polymeraseDepositorInsertdgat2 (dgat2 Zebrafish)
UseIn vitro transcriptionTagsExpressionMutationPromoterSP6/T7Available sinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ HA-BEX4
Plasmid#231005PurposeTransient overexpression of human BEX4 in mammalian cellsDepositorInsertBEX4 (BEX4 Human)
UseTagsHAExpressionMammalianMutationPromoterAvailable sinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
CamKII-mtPyronicSF
Plasmid#228906PurposeExpression of mtPyronicSF in neurons targeted to the mitochondria serving as an optical sensor for mitochondrial pyruvate uptake. Backbone from Addgene plasmid 100834DepositorInsertpyronic SF
UseAAVTagsCox8 targettingExpressionMammalianMutationPromoterCamKIIAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-Twin-strep-TEV-DGKδ2-DSAMD
Plasmid#223721PurposeExpress human diacylglycerol kinase delta 2- SAM domain deletion mutant (N-terminal TEV protease cleavable Twin-Strep-fusion protein) in mammalian cellDepositorInsertDGKD (DGKD Human)
UseTagsTEV cleavable site and Twin-Strep-tagExpressionMammalianMutationdeleted sterile alpha motif domain (deleted amino…PromoterCAG and chicken β-actin promoterAvailable sinceJan. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3E-EF1a-pA (JDW 1222)
Plasmid#224526PurposeA Gateway compatible 3' entry clone containing rat EF-1a polyADepositorInsertEF-1a polyA
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
p40651-EFSNS-FMR1_e1-24xms2
Plasmid#222968PurposeMS2 mRNA reporter with intact FMR1 5' UTR and exon 1 sequenceDepositorInsertFMR1-31CGG 5' UTR and exon1
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only