We narrowed to 7,341 results for: mCherry
-
Plasmid#105800PurposeConcomitant expression of two proteins. One protein is expressed with mCherry fusion tag (at the C-terminus), cleavable by TEV protease; second tag introduced by user.DepositorTypeEmpty backboneUseFlp-in competentTagsTEV-mCherryExpressionMammalianAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pmCherry_I3
Plasmid#239340PurposeExpresses the I3-01 nanocage subunit N-terminally tagged with mCherry in mammalian cells. Assembles into nanocages tagged with 60 FPs.DepositorInsertI3-01
TagsmCherryExpressionMammalianMutationK129APromoterCMVAvailable sinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available sinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-PytR(A2.1)-mCherry
Plasmid#204869PurposeExpresses pyrrolysyl tRNA variant "A2.1" and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertM. mazei pyrrolysyl tRNA mutant "A2.1"
UseAAVExpressionMammalianMutationU25C; A3G, A4G, T65C, T66C, T67TPromoterU6Available sinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CamkII-bPac(WT)-mCherry-minWPRE.sbd
Plasmid#118278PurposeExpresses bPAC(WT)-mCherry under a minimal CamKII PromoterDepositorInsertbPAC(WT)
UseAAVTagsmCherry and mycPromoterCamKIIAvailable sinceJune 18, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHR-GAL4-IL10-IRES-mCherry-PGK-BFP
Plasmid#223209PurposeLentiviral vector - mCherry reporter and IL10 for Gal4DBDVP64 synNotch receptors with a constitutive BFPDepositorAvailable sinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-SRRM2-gRNA
Plasmid#238251PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to SRRM2 locusDepositorInsertSRRM2
UseCRISPRAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-TCOF1-gRNA
Plasmid#237633PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to TCOF1 locusDepositorAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETM6-3A2-mCherry
Plasmid#73425PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 3A2.DepositorInsertPromoter 3A2 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3A2 (orthogonal T7-lac variant)Available sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETM6-3F2-mCherry
Plasmid#73418PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 3F2.DepositorInsertPromoter 3F2 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3F2 (orthogonal T7-lac variant)Available sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Tet-O-FUW-NR4A3-P2A-mCherry
Plasmid#203863PurposeTet-inducible lentiviral plasmid expressing NR4A3-P2A-mCherry, with ORF specific barcode close to 3'LTR siteDepositorInsertNR4A3 (NR4A3 Human)
ExpressionMammalianAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Tet-O-FUW-EGFP-P2A-mCherry
Plasmid#203868PurposeTet-inducible lentiviral plasmid expressing EGFP-P2A-mCherry, with ORF specific barcode close to 3'LTR siteDepositorInsertEGFP
ExpressionMammalianAvailable sinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tet-O-FUW-NR4A1-P2A-mCherry
Plasmid#203859PurposeTet-inducible lentiviral plasmid expressing NR4A1-P2A-mCherry, with ORF specific barcode close to 3'LTR siteDepositorInsertNR4A1 (NR4A1 Human)
ExpressionMammalianAvailable sinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJRK249
Plasmid#173747PurposeCeLINC plasmidDepositorInsertPrps-0::CRY2(olig)::VHH(mCherry)::unc-54 3' UTR
ExpressionWormPromoterPrps-0Available sinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOPS0378
Plasmid#133229PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with constitutive promoter pNeo (pOGG001), mCherry (EC15071) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable sinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-EcYtR-mCherry
Plasmid#217362PurposeExpresses E. coli tyrosine tRNA and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertE. coli tyrosine tRNA
UseAAVExpressionMammalianPromoterU6Available sinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ITR-PytR-mCherry
Plasmid#204868PurposeExpresses pyrrolysyl tRNA and a wild-type mCherry reporter; can be packaged into AAVDepositorInsertM. mazei pyrrolysyl tRNA
UseAAVExpressionMammalianMutationU25CPromoterU6Available sinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUb-Cas9-mCherry_cU6:6-sgRNA
Plasmid#190598PurposeThe plasmid encodes S. pyogenes Cas9 and mCherry separated by a T2A peptide under an Aedes aegypti polyubiquitin promoter. It also expresses a sgRNA scaffold under a Culex quinquefasciatus U6 promoterDepositorInsertsCas9
sgRNA
UseCRISPRTagsmCherry - separated by T2APromoterAedes aegypti polyubiquitin and Culex quinquefasc…Available sinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
IronFist
Plasmid#243006PurposeGenetically encoded fluorescent iron reporterDepositorInsertsUseGateway CloningTagsmNeonGreenExpressionMammalianPromoterhuman phosphoglycerate kinase (hPGK)Available sinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYSD329
Plasmid#253041PurposeEncodes the Aga2 signal peptide, anti-mCherry_LaM4 nanobody, HA-tagged 649-stalk yeast surface display anchor protein in a yeast expression vector with pTEF1 promoter, LEU2 selectable markerDepositorInsertAnti-mCherry_LaM-4 nanobody 649-stalk anchor
ExpressionYeastAvailable sinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only