167,150 results
-
Plasmid#8365DepositorInserthuman Fc epsilon RI alpha cDNA (FCER1A Human)
ExpressionMammalianAvailable SinceMay 24, 2006AvailabilityAcademic Institutions and Nonprofits only -
pX333
Plasmid#64073PurposeVector for tandem expression of two sgRNAs from two independent U6 promoters. Cas9 is expressed by Cbh promoter.DepositorHas ServiceCloning Grade DNATypeEmpty backboneTags3XFLAG-Cas9ExpressionMammalianPromoterCBh; U6Available SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
SypHer
Plasmid#48250PurposepH sensorDepositorInsertSypHer
ExpressionMammalianMutationC199SPromoterCMVAvailable SinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHSN6A01
Plasmid#50586PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-VP64, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertsdCas9-VP64
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG, HA, and NLSMutationdCas9 = defective in DNA cleavage; 4×minimal VP16…Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
hNTo2-qgRNA-pYJA5
Plasmid#217782PurposeNon-targeting control 2 qgRNA-pYJA5 plasmid from the T.spiezzo library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene ablation
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-UNC93A_STOP
Plasmid#161448PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertUNC93A (UNC93A Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCAG-Eco
Plasmid#35617DepositorInsertEcotropic MLV envelope
ExpressionMammalianAvailable SinceJuly 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLminP_Luc2P_RE1
Plasmid#90335PurposeNFkB - p50/p65 pathway gene reporterDepositorInsertFirefly luciferase
UseLentiviralPromoterNFKBAvailable SinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPB-EF1α-H2B-HaloTag-IRES-puro
Plasmid#247460PurposePiggybac based mammalian expression vector for histone H2B HaloTag, driven by the EF1a promoter.DepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only