We narrowed to 38,427 results for: ANT
-
Plasmid#173788PurposeMammalian expression of SARS-CoV-2 Spike protein South African variant version 4DepositorInsertSpike (S-GSAS-B.1.351 variant version 4) (S Severe acute respiratory syndrome coronavirus 2)
UseTagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…PromoterAvailable sinceJan. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pnCS_DSep2_Peanut-TEV-Strep
Plasmid#174495Purposebacterial co-expression of Drosophila Sep2 and of Drosophila PeanutDepositorUseTagsTEV-StrepExpressionBacterialMutationPromoterAvailable sinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN4(TA)-ires-blast
Plasmid#167831PurposeControl sensor for EKAREN4DepositorInsertEKAREN4(TA)
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426W, T420APromoterEF1aAvailable sinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIGF1_P1 Promoter-FLuc2P
Plasmid#154261PurposeDestabilized firefly luciferase reporter containing the canonical Human IGF-1 P1 Promoter.DepositorInsertIGF-1 canonical P1 Promoter (IGF1 Human)
UseTagsExpressionMammalianMutationPromoterHuman IGF-1 P1 PromoterAvailable sinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIGF1_P2 Promoter-FLuc2P
Plasmid#154262PurposeDestabilized firefly luciferase reporter containing the downstream Human IGF-1 P2 Promoter.DepositorInsertIGF-1 P2 Promoter (IGF1 Human)
UseTagsExpressionMammalianMutationPromoterHuman IGF-1 P2 PromoterAvailable sinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3_SARS2_BQ.1.1
Plasmid#194493Purposeexpressing SARS-CoV-2 BQ.1.1 spike protein for pseudovirus productionDepositorInsertSpike (BQ.1.1) (S SARS-CoV-2)
UseTagsExpressionMammalianMutationR346T, K444T, N460K and c-terminal 18aa del on th…PromoterCMVAvailable sinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3_SARS2_XBB
Plasmid#194494Purposeexpressing SARS-CoV-2 XBB spike protein for pseudovirus productionDepositorInsertSpike (XBB) (S SARS-CoV-2)
UseTagsExpressionMammalianMutationV83A, Y144-,H146Q, Q183E, V213E, G339H, L368I, R3…PromoterCMVAvailable sinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
PGL4.11-COL1A1mSMAD
Plasmid#230917PurposeTested the COL1A1 promoter activity after abolition of the proximal SMAD binding sites in the promoter.DepositorInsertHuman COL1A1 promoter with mutant SMAD binding sequence (COL1A1 Human)
UseLuciferaseTagsLuciferase-luc2pExpressionBacterial and MammalianMutationCOL1A1 promoter with mutant potential SMAD bindin…PromoterCOL1A1Available sinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12D/sgKras/Cre
Plasmid#99851PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12D mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDmelOR-mRho.V5.mER.hOr56a
Plasmid#126479PurposeHuman codon-optimized D. melanogaster Orco (hOrco) and Or56a (hOr56a). Or56a has N-terminal tags derived from human Rhodopsin (mRho) and HCN1 (mER) for improved trafficking in mammalian cellsDepositorUseTagsH. sapiens HCN1 106VNKFSL111 (mER), H. sapiens Rh…ExpressionMammalianMutationcodon optimization for H. sapiens and codon optim…PromoterCMVAvailable sinceJune 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMB1_1R26PylRS(CbzK)_AfTyrRS(p-I-Phe)_AlvtRNA-ΔNPyl(8)(CGA)_AftRNA-Tyr(A01)(CUA)
Plasmid#174516PurposeRecoded double aaRS/tRNA plasmid with 1R26PylRS/AlvtRNA-ΔNPyl(8)(CGA) & AfTyrRS/AftRNA-Tyr(A01)(CUA) to incorporate CbzK into the TCG codon & p-I-Phe into the TAG codon.DepositorInsertsPylS_1R26 - CBZK
Af_TyrRS - p-I-Phe
Ma tRNA pylT(8) with CGA anticodon
A.fulgidus tRNA with CUA anticodon
UseTagsExpressionBacterialMutationCUA anticodon, M.alvus Pyl tRNA with CGA anticodo…PromoterGlnS and lppAvailable sinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12C/sgKras/Cre
Plasmid#99850PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12C mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12V/sgKras/Cre
Plasmid#99854PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12V mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasWT/sgKras/Cre
Plasmid#99848PurposeExpresses Cre-recombinase, a barcoded HDR template that serves as a control for HDR into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13C/sgKras/Cre
Plasmid#99856PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13C mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLEX303 TagRFP-T LGALS3 R186S
Plasmid#202428PurposeExpression of TagRFP-T-tagged Galectin 3 with mutation of carbohdrate recognition binding domain (CRD) (R186S mutant)DepositorInsertLGALS3 (LGALS3 Human)
UseLentiviralTagsTagRFPExpressionMutationR186SPromoterAvailable sinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12R/sgKras/Cre
Plasmid#99852PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13D/sgKras/Cre
Plasmid#99857PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13D mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12S/sgKras/Cre
Plasmid#99853PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12S mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12A/sgKras/Cre
Plasmid#99849PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12A mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13V/sgKras/Cre
Plasmid#99860PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13V mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293A
Plasmid#115204PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293A (PDHA2 Human)
UseLentiviralTagsExpressionMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A/S293A
Plasmid#115205PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A/S293A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A/S293A (PDHA2 Human)
UseLentiviralTagsExpressionMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…ExpressionMutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralTagsExpressionMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralTagsExpressionMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable sinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13S/sgKras/Cre
Plasmid#99859PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13S mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13A/sgKras/Cre
Plasmid#99855PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13A mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13R/sgKras/Cre
Plasmid#99858PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3-SARS2-B.1.617.2
Plasmid#172320Purposeexpressing SARS-CoV-2 B.1.617.2 spike protein (delta strain) for pseudovirus production.DepositorInsertSpike of B.1.617.2 strain (S SARS-CoV-2)
UseTagsExpressionMammalianMutationT19R, 156G, 157-158del, L452R, T478K, D614G, P681…PromoterCMV-FAvailable sinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDmelOR-mRho.V5.mER.hOr47a
Plasmid#126478PurposeHuman codon-optimized D. melanogaster Orco (hOrco) and Or47a (hOr47a). Or47a has N-terminal tags derived from human Rhodopsin (mRho) and HCN1 (mER) for improved trafficking in mammalian cellsDepositorUseTagsH. sapiens HCN1 106VNKFSL111 (mER), H. sapiens Rh…ExpressionMammalianMutationcodon optimization for H. sapiens and codon optim…PromoterCMVAvailable sinceJune 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3-SARS2-B.1.617.1
Plasmid#172319Purposeexpressing SARS-CoV-2 B.1.617.1 (kappa strain) spike protein for pseudovirus productionDepositorInsertSpike of B.1.617.1 strain (S SARS-CoV-2)
UseTagsExpressionMammalianMutationG142D, E154K, L452R, E484Q, D614G, P681R, Q1071H,…PromoterCMVAvailable sinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor smFP-HA (dark) WPRE
Plasmid#131007PurposeMADR donor plasmid for FlpO+Cre- mediated insertion of SM_FP-HA, a cytoplasmic fluorescent protein which includes multiple HA epitope tagsDepositorInsertsmFP-HA WPRE
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsHA - 10 total HA epitope tagesExpressionMammalianMutation"dark" variant with GGG fluorphore comp…Promoternone (4x polyA to mitigate episomal expression)Available sinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor smFP-V5 (dark) WPRE
Plasmid#131006PurposeMADR donor plasmid for FlpO+Cre- mediated insertion of a SM_FP-V5, a cytoplasmic fluorescent protein which includes multiple V5 epitope tagsDepositorInsertsmFP-V5 WPRE
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsV5 - 10 total of V5 epitope tagExpressionMutation"dark" variant with GGG fluorphore comp…Promoternone (4x polyA to mitigate episomal expression)Available sinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor smFP-Myc (dark) WPRE
Plasmid#130987PurposeMADR donor plasmid for FlpO+Cre- mediated insertion of a SM_FP-Myc, a cytoplasmic fluorescent protein which includes multiple Myc epitope tagsDepositorInsertsmFP-Myc WPRE
UseMosaic analysis for dual recombinase-mediated cas…TagsMyc - 10 total Myc tagsExpressionMutation"dark" variant with GGG fluorophore ver…Promoternone (4x polyA to mitigate episomal expression)Available sinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCV-N MCV ST
Plasmid#37861DepositorInsertMCV ST (MCPyV_gp2 Human Merkel Cell Virus)
UseRetroviralTagsFlag and HAExpressionMammalianMutationPromoterPKGAvailable sinceJuly 23, 2012AvailabilityAcademic Institutions and Nonprofits only