We narrowed to 7,325 results for: 11
-
Plasmid#164610PurposeExpress the endocannabinoid sensor GRAB_eCB2.0 in FLP positive cellsDepositorInsertEndocannabinoid sensor GRAB_eCB2.0
UseAAVMutationS383TPromoterEFSAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-BTC-ScNeo
Plasmid#209898PurposeTo monitor the status of Betacellulin, the plasmid encodes a recombinant BTC fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-Necl5-ScNeo
Plasmid#209901PurposeTo monitor the status of Necl-5, the plasmid encodes a recombinant Necl-5 fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EMTB-TurboID-V5-puro
Plasmid#190741PurposeA lentiviral plasmid encoding EMTB fusion to V5-tagged TurboID on microtubules (EMTB as the microtubule-targeting tag)DepositorInsertEMTB-TurboID-V5 (RPS14 EMTB is human ensconsin; TurboID is engineered BirA from E.coli, Human)
UseLentiviralTagsMycExpressionMammalianMutationMicrotubule binding-domain of ensconsin (amino ac…PromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-eGFP-Ago2
Plasmid#74231PurposeGFP-Ago2 lentiviral vectorDepositorAvailable SinceApril 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-RNF138-WT
Plasmid#78920PurposeMammalian expression of RNF138 with an EGFP fusionDepositorAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GRAB_eCB2.0mut
Plasmid#164607PurposeExpress the endocannabinoid non-responsive sensor GRAB_eCB2.0 in Cre positive neuronsDepositorInsertEndocannabinoid non-responsive sensor GRAB_eCBmut
UseAAVMutationS383T, F177APromoterhSynAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Blast-sgNT
Plasmid#138678PurposeExpresses a Non-targeting sgRNA and Cas9DepositorInsertsgNT
UseLentiviralPromoterhU6Available SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_antiCD19_eZ3_Gal4VP64
Plasmid#169917PurposeExpression of a synNotch receptor containing antiCD19, a zebrafish Notch3 core with an additional EGF repeat, and Gal4VP64.DepositorInsertantiCD19-Notch3-GL4VP64
UseLentiviralExpressionMammalianMutationAdditional EGF repeat between the extracellular d…PromoterPGKAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase INF enhancer vector_ORI_IFIT2
Plasmid#99321PurposeLuciferase validation vector with IFIT2 enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr10: 91060605-91062447
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
CMV-FLAG-TAOK2
Plasmid#197862PurposeExpression of FLAG-tagged TAOK2 / PSK1 alpha in mammalian cellsDepositorAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
Chicken Mermaid S188
Plasmid#53617PurposeGenetically encoded voltage sensor based on mUKG-mKOk FRET pairDepositorInsertChicken Mermaid S188
ExpressionMammalianMutationGg-VSP contains an R153Q mutation and an amino ac…PromoterCMVAvailable SinceAug. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFrt-invCAG-ires-Luc
Plasmid#63576PurposeShuttle vector compatible with Flp-mediated (Flp-in) transgene integration that allows for conditional cDNA and Luc expression upon integration. The vector contains an FRT site and two mut loxP sites.DepositorInsertStop-Lox71-IRES-Luciferase-pA-FRT-Lox66-reverseCAG
UseCre/Lox; Frt/flpe recombination mediated insertionExpressionMammalianPromoterCAGAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 SV40-CMV-SaCas9-3xNLS
Plasmid#78601PurposeAAV vector containing SaCas9DepositorInsertSV40-CMV-SaCas9-3xNLS
UseAAV and CRISPRTagsHA tagExpressionMammalianPromoterSV40, CMV promotersAvailable SinceDec. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFPV25-cR-2iG
Plasmid#204618PurposeFluorescent reporter for SPI2 induction in SalmonellaDepositorInsertsrpsM promoter
sseA promoter
TagsGFP and dsRedExpressionBacterialAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
Chicken ArcLight A173
Plasmid#53615PurposeGenetically encoded voltage sensor ArcLight with improved kineticsDepositorInsertChicken ArcLight-A173
ExpressionMammalianMutationGg-VSP contains an R153Q mutation and an amino ac…PromoterCMVAvailable SinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pODN-mNG-RHOA
Plasmid#183836PurposeRepair template for the N-terminal tagging of RhoA with mNeonGreen in human cells using CRISPR/Cas9.DepositorInsertRHOA homology arms with mNeonGreen-linker (RHOA Human)
UseCRISPR; Donor templateTagsmNeonGreen-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-UAP56
Plasmid#157661PurposeExpresses UAP56 in E.coli cellDepositorInsertSpliceosome RNA helicase DDX39B (DDX39B Human)
TagsGST tagExpressionBacterialMutationdeleted amino acids 1-43Available SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRI005-pYFAC-riboB-PgpdA-dLbCpf1(D156R)-VPR-TtrpC
Plasmid#140198PurposeEpisomal expression of dLbCpf1(D156R)-VPR, variant for culture at room temperature. Filamentous fungi vector with AMA1 and riboB selection marker.DepositorInsertdLbCas12a(D156R)-VPR
UseCRISPR and Synthetic Biology; Expression in asper…TagsVPR (VP64-p65-Rta), NLSMutationD832A DNase deactivated, D156R for improved activ…PromoterPgpdAAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only