We narrowed to 4,997 results for: mcs
-
Plasmid#235688PurposeExpress RFP tagged MST2 gene in mammalian cells using the CMV promoterDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only
-
GFP-LiMETER-v1
Plasmid#113933PurposeExpress an optogenetic tether to label and interrogate ER-plasma membrane contact sites (MCS); visualized by GFPDepositorInsertLOV2 and Rit polybasic domain (PB)
TagsGFPExpressionMammalianPromoterCMVAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-102.1F10-IgG4/λ
Plasmid#50369PurposeExpresses grass pollen allergen Phl p 7 specific human IgG4/λ antibody isotype (102.1F10-IgG4/λ)DepositorInsertsgrass pollen allergen Phl p 7 specific human Gamma 4 heavy chain expression cassette
grass pollen allergen Phl p 7 specific human lambda light chain expression cassette
ExpressionMammalianPromoterMouse Elongation Factor 1 Alpha and Rat Elongatio…Available SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAR100
Plasmid#180377PurposepAR100 allows cloning of TCRα and TCRβ genes using restriction enzymes (AflII, ApaI, and SacII).DepositorInsertsNFAT-Luciferase
hCD8A
ExpressionBacterial and MammalianPromoterhEF1-HTLV and minimal promoter and an NFAT respon…Available SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
FUW-tetO-YAPS94A
Plasmid#84010Purposeexpresses a TEAD-binding mutant of YAP (YAPS94A) in mammalian cells under the control of a doxycycline-inducible promoterDepositorInsertYAP1 (siRNA insensitive) (YAP1 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationS94APromoterTRE-CMVAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-102.1F10-IgA2/λ
Plasmid#50371PurposeExpresses grass pollen allergen Phl p 7 specific human IgA2/λ antibody isotype (102.1F10-IgA2/λ)DepositorInsertsgrass pollen allergen Phl p 7 specific human Alpha 2 heavy chain expression cassette
grass pollen allergen Phl p 7 specific human lambda light chain expression cassette
ExpressionMammalianPromoterMouse Elongation Factor 1 Alpha and Rat Elongatio…Available SinceApril 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDH-CMV-RPS4X-3xHA plasmid
Plasmid#192246Purposeoverexpression vector of RPS4X-3XHADepositorAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-102.1F10-IgG2/λ
Plasmid#50367PurposeExpresses grass pollen allergen Phl p 7 specific human IgG2/λ antibody isotype (102.1F10-IgG2/λ)DepositorInsertsgrass pollen allergen Phl p 7 specific human Gamma 2 heavy chain expression cassette
grass pollen allergen Phl p 7 specific human lambda light chain expression cassette
ExpressionMammalianPromoterMouse Elongation Factor 1 Alpha and Rat Elongatio…Available SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVITRO1-102.1F10-IgG3/λ
Plasmid#50368PurposeExpresses grass pollen allergen Phl p 7 specific human IgG3/λ antibody isotype (102.1F10-IgG3/λ)DepositorInsertsgrass pollen allergen Phl p 7 specific human Gamma 3 heavy chain expression cassette
grass pollen allergen Phl p 7 specific human lambda light chain expression cassette
ExpressionMammalianPromoterMouse Elongation Factor 1 Alpha and Rat Elongatio…Available SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
JWW-2 human chimeric monoclonal antibody
Plasmid#66749PurposeExpresses a murine/human chimeric IgG1 HPV16 L2-specific neutralizing antibody that recognizes HPV16 L2 amino acid region 58-64 . JWW-2 works in ELISA/WB/HPVDepositorInsertsJWW-2 Heavy Chain
JWW-2 Light Chain
ExpressionMammalianPromotermEF1 and rEF1Available SinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcsII-pb4-flag
Plasmid#86768PurposeC-terminal flag-tagged protein expression in mammalian cells, lentiviral vectorDepositorInsertproteasome beta subunit 4 (PSMB4 Human)
UseLentiviralTagsflagExpressionMammalianPromoterEF-1aAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
ssAAV-EF1a-FLuc-WPRE-HgHpA_bac_293
Plasmid#118412PurposeExpresses firefly luciferase under the control of a strong ubiquitous promoter EF1a along with a WPRE cassette. Backbone is compatible with both baculoviral and human production methods of AAV.DepositorInsertFirefly luciferase
UseAAV, Luciferase, and Synthetic BiologyExpressionInsect and MammalianPromoterEF1aAvailable SinceNov. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-STAT3
Plasmid#195575PurposeExpresses STAT3DepositorInsertSignal transducer and activator of transcription 3 (Stat3 Mouse)
UseAAVExpressionMammalianPromoterCMV enhancer and promoterAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGAL4-DBD-CEBPa-WT
Plasmid#215601PurposeFor overexpression of Gal4-DBD CEBPa WTDepositorInsertCEBPa (CEBPA Human)
ExpressionMammalianAvailable SinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CNTF-HA
Plasmid#195517PurposeExpresses HA-tagged CNTF in mammalian cellsDepositorInsertCiliary neurotrophic factor (CNTF Human)
UseAAVTagsHA-tag and NGF signal peptideExpressionMammalianPromoterUbC promoter with beta-globin intronAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCW57-mCherry-2A-BRD4 Iso CdelET
Plasmid#137723PurposeDoxycycline Inducible Expression of mCherry-2A-FLAG-BRD4 long short missing its extra-terminal domain (ET)DepositorInsertBRD4 short isoform with deleted extra-terminal domain (BRD4 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationDeleted amino acids 600-682PromoterTight TRE promoterAvailable SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hyg-Snrnp40-CRISPR-resistant
Plasmid#134251PurposeLentivector encoding CRISPR-resistant Snrnp40DepositorInsertSnrp40 (Snrnp40 Mouse)
UseLentiviralExpressionMammalianMutationmutated coding sequence “gataactatgcgacgttgaa” to…PromoterEF1aAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
PAX3::FOXO1-2A-sfGFP
Plasmid#240098Purposehuman PAX3::FOXO1 in -2A-sfGFP backbone (Plasmid# 74668)DepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hADAR1_1k)-PGKpuro2ABFP-W
Plasmid#208433PurposeLentiviral gRNA plasmid targeting human ADAR1 gene, co-expression of BFP tagDepositorInsertADAR1 (ADAR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U7Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hPKR_2g)-PGKpuro2AmCherry-W
Plasmid#208435PurposeLentiviral gRNA plasmid targeting human PKR gene, co-expression of mCherry tagDepositorInsertPKR (EIF2AK2 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U9Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only