We narrowed to 4,452 results for: 256
-
Plasmid#74413PurposeExpresses mouse eGFP-IKKα in mammalian cellsDepositorAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only
-
SNS-GFP
Plasmid#163662PurposeExpresses a TNF and ST6GAL1 swapped chimera with the cytosolic tail from ST6GAL1, TMD from TNF and luminal domain from ST6GAL1 in mammalian cellsDepositorInsertTagsGFPExpressionMammalianMutationThis chimera contains the cytosolic tail from ST,…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001145502)
Plasmid#76851Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001148405)
Plasmid#76852Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001146399)
Plasmid#76853Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001148106)
Plasmid#76854Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Anti-Tmem119 [L128/18R]
Plasmid#225367PurposeMammalian Expression Plasmid of anti-Tmem119 (Mouse) IgG2a R-mAb. Derived from hybridoma L128/18.DepositorInsertAnti-Tmem119 (Mus musculus) recombinant (Mouse) monoclonal antibody. (Tmem119 Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
NSS-GFP
Plasmid#163661PurposeExpresses a TNF and ST6GAL1 swapped chimera with the cytosolic tail from TNF and TMD and luminal domain from ST6GAL1 in mammalian cellsDepositorInsertTagsGFPExpressionMammalianMutationThis chimera contains the cytosolic tail from TNF…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
SNN-GFP
Plasmid#163664PurposeExpresses a TNF and ST6GAL1 swapped chimera with the cytosolic tail from ST6GAL1, and TMD and luminal domain from TNF in mammalian cellsDepositorInsertTagsGFPExpressionMammalianMutationThis chimera contains the cytosolic tail from ST,…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
NNS-GFP
Plasmid#163666PurposeExpresses a TNF and ST6GAL1 swapped chimera with the cytosolic tail and TMD from TNF, and luminal domain from ST6GAL1 in mammalian cellsDepositorInsertTagsGFPExpressionMammalianMutationThis chimera contains the cytosolic tail from TNF…Available SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_FURIN_WT
Plasmid#82122PurposeGateway Donor vector containing FURIN , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pIRES2-smGFP-Kv2.1
Plasmid#131709PurposeExpresses Kv2.1 in mammalian cellsDepositorAvailable SinceOct. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-HKDC1
Plasmid#23613DepositorInsertHKDC1 (HKDC1 Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-IL2RA CaRE6 (plus strand)
Plasmid#91839PurposeLuciferase reporter for IL2RA enhancer (IGI-P0616)DepositorInsertIL2RA CaRE6 (plus strand) (IL2RA Human)
UseLuciferaseExpressionMammalianMutationrs7893467 G>T, rs11256448 A>GAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only