We narrowed to 13,721 results for: CRISPR-Cas9
-
Plasmid#194306PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(EGFP)
UseBacterial cloning vectorAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro EGFP nLAP +2
Plasmid#194307PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(EGFP)
UseBacterial cloning vectorAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro EGFP nLAP +0
Plasmid#194305PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(EGFP)
UseBacterial cloning vectorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBC2102-reci
Plasmid#117171PurposeU6-sgRNA-EFS-Cas9-T2A-mCherry-P2A-Hygro; wtCas9 without NLSDepositorInsertreci_wtCas9 without NLS
UseLentiviralPromoterU6 PromoterAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro BFP nLAP +0
Plasmid#194317PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(BFP)
UseBacterial cloning vectorAvailable SinceSept. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro BFP nLAP -1
Plasmid#194324PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(BFP)
UseBacterial cloning vectorAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro BFP nLAP -0
Plasmid#194323PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(BFP)
UseBacterial cloning vectorAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro BFP nLAP -2
Plasmid#194325PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(BFP)
UseBacterial cloning vectorAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro BFP nLAP +1
Plasmid#194318PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(BFP)
UseBacterial cloning vectorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro BFP nLAP +2
Plasmid#194319PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(BFP)
UseBacterial cloning vectorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
RPL13A_PQR_mScarlet_NOL_LoxP_PQR_zeo_PQR_MCS_RPL13A-3'UTR
Plasmid#165043PurposeRepair template for CAS9 complex genome editingDepositorInsertRPL13A (RPL13A Human)
ExpressionBacterialAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSP1101
Plasmid#65773PurposeHuman expression vector for SpCas9 VRER variant: CMV-T7-humanSpCas9(D1135V/G1218R/R1335E/T1337R)-NLS-3xFLAG (VRER variant)DepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135V/G1218R/R1335E/T1337R)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135V, G1218R, R1335E, and T1337R mutations in C…PromoterCMV & T7Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHEE401E
Plasmid#71287PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertsgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 enhancer fused to EC1.1 promoter and U6-26p…Available SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pXPR_011
Plasmid#59702PurposeThis lentiviral vector can be used to assay Cas9 activity.DepositorInsertEGFP sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCasPA
Plasmid#113347PurposeBacterial expression of Cas9 nuclease and λ-Red system in Pseudomonas aeruginosaDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCasAb-apr
Plasmid#121998PurposeBacterial expression of Cas9 nuclease and RecAb recombination system in Acinetobacter baumanniiDepositorTypeEmpty backboneUseCRISPRExpressionBacterialAvailable SinceSept. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEC-red
Plasmid#196040PurposeAllows the expression of Cas9 in Saccharomyces cerevisiae and contains a gRNA expression unit with a mRFP1 placeholder for user-defined gRNA insertion using BsaI-mediated Golden Gate AssemblyDepositorTypeEmpty backboneUseCRISPR and Synthetic Biology; Grna cloningExpressionYeastAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC gRNA Shuttle
Plasmid#47024PurposeEncodes a template from which gRNAs can be made via InFusion cloning. The Medicago truncatula U6.6 promoter drives the gRNA. For use in plants.DepositorInsertgRNA Shuttle
UseCRISPR; Cas9ExpressionPlantMutationG to T cloning mutation at position 323PromoterMedicago truncatula U6.6Available SinceSept. 3, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits