We narrowed to 6,844 results for: tet
-
Plasmid#169732PurposeEqualizer variant plasmid with low eGFP output levels but the best gene dosage compensation capability.DepositorInsertmiR(FF4) target-tetR-P2A-eGFP-miR(FF4) target-miR(FF4)
UseSynthetic BiologyExpressionMammalianPromoterpCMV-tetO2Available SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pASK-mSAN1-Streptag
Plasmid#117165PurposeExpresses Strep-tagged murine SAN1 nuclease in bacteriaDepositorAvailable SinceOct. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
MLM3727
Plasmid#49961PurposeExpresses a 3x Flag TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding siteDepositorAvailable SinceJan. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-TeNT-P2A-EGFP
Plasmid#176282PurposeViral vector for co-expression of TeNT and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertTeNT-P2A-EGFP
UseAAV and Cre/LoxExpressionMammalianPromoterhuman Synapsin IAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGLTR-FP-GFP
Plasmid#58242PurposeGATEWAY-compatible lentiviral RNAi delivery vector; SFFV-driven eGFP markerDepositorInsertattR1-Cm(R)-CcdB-attR2
UseLentiviral and RNAi; Gateway destionation vectorExpressionMammalianPromoternoAvailable SinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBA615
Plasmid#186239PurposeeLbuCas13a Negative Control (RFP targeting)DepositorInsertpTet-eLbuCas13a + crRNA negative control
ExpressionBacterialAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCph8
Plasmid#50552PurposeExpresses Cph8 under a modified PLtetO-1 promoterDepositorInsertCph8
UseSynthetic BiologyExpressionBacterialAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pR I-Ab beta Derp1-117
Plasmid#113639PurposeInsect cell expression vector for I-Ab beta chain fused to Der p 1 117-127 antigenic peptideDepositorInsertI-Ab beta Derp1-117 (H2-Ab1 Mouse)
Tags6x His tag, fused to Der p 1 (117-127) peptide vi…ExpressionInsectMutationtransmembrane and cytoplasmic domains truncatedPromoterMetallothioneinAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFU-cMVIIA-PE
Plasmid#24147DepositorInsertloxP-DsRed-loxP-omega-Conotoxin MVIIA-FLAG-PDGF_R_TM-EGFP (PDGFRB Human, Conus magus, Aequorea victoria)
UseLentiviralExpressionMammalianAvailable SinceMarch 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET His6 MBP TEV HDAC8_374
Plasmid#122174PurposeExpresses a truncated construct of histone deacetylase 8 for crystallography bearing an N-terminal tobacco etch virus protease-cleavable hexahistidine-maltose binding protein tagDepositorInsertHis6 MBP TEV HDAC8_374 (HDAC8 Human)
Tagshexahistidine tag and tobacco etch virus protease…ExpressionBacterialMutationResidues Met1–Pro7 and H375-V377 have been delete…PromoterT7Available SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFF145
Plasmid#61446PurposeaTc-inducible Beta recombinaseDepositorInsertBeta recombinase
UseSynthetic BiologyPromoterpTetOAvailable SinceFeb. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRRLNeo-pEF1a-p53ash-mCerulean
Plasmid#69579PurposeExpresses p53 tagged with mCeruleanDepositorInsertp53 (TP53 Human)
UseLentiviralTagsmCeruleanExpressionMammalianMutation7 silent mutations in p53 DNA to prevent targetin…PromoterEF1alphaAvailable SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-NHA
Plasmid#115359PurposeCloning vector to produce NHA-fusion proteins without any other gene insertDepositorInsertN peptide and HA
TagsN peptide and HAExpressionMammalianPromoterCMVAvailable SinceSept. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLNC Wnt-3
Plasmid#17993DepositorInsertWnt-3 (WNT3 Human)
UseRetroviralAvailable SinceJuly 7, 2008AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ Myc2-mouse TTP aa S52 S178 MUT
Plasmid#107001PurposeExpresses epitope-tagged double-mutant murine TTPDepositorInserttristetraprolin (Zfp36 Mouse)
TagsDouble Myc peptide epitope tagExpressionMammalianMutationChanged Ser52 to Ala and Ser178 to AlaAvailable SinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP mScarlet-MOSPD2 WT
Plasmid#186472PurposeExpression of human MOSPD2 fused to mScarlet in mammalian cellsDepositorInsertMOSPD2 motile sperm domain containing 2 (MOSPD2 Human)
UseRetroviralTagsmScarletExpressionMammalianAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV pTRE-FSF-FLEX-EGFP-WPRE-bGHpA
Plasmid#65453PurposeCan be used to generate AAV virus that will express EGFP from the tetO promoter under intersectional control by Flp and Cre recombinasesDepositorHas ServiceAAV1InsertEGFP
UseAAVPromotertetOAvailable SinceJan. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKB225
Plasmid#170015PurposeEncodes LacI-controlled expression of surface display protein with no C-terminal peptide and PvirK-mNeonGreen reporterDepositorArticleInsertsmNeonGreen
Peptide display protein with no C-terminal peptide
UseSynthetic BiologyTagsLpp, OmpA, and TetherExpressionBacterialPromoterPtac and PvirKAvailable SinceNov. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJZC32
Plasmid#62327PurposesgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+) 6xHis-3xFlag-IFIT5
Plasmid#53561Purposebacterial expression of IFIT5DepositorAvailable SinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits only