We narrowed to 6,451 results for: siae
-
Plasmid#90253Purposeprotein expressionDepositorInsertBRR2
TagsTAPExpressionYeastMutationdeleted first 113 amino acids and amino acid N110…AvailabilityAcademic Institutions and Nonprofits only -
pSL7 - Brr2 del247 N1104L
Plasmid#90257Purposeprotein expressionDepositorInsertBRR2
TagsTAPExpressionYeastMutationdeleted first 247 amino acids and N1104LAvailabilityAcademic Institutions and Nonprofits only -
pSL11 - Brr2 del422 N1104L
Plasmid#90261Purposeprotein expressionDepositorInsertBRR2
TagsTAPExpressionYeastMutationdeleted first 422 amino acids and amino acid N110…AvailabilityAcademic Institutions and Nonprofits only -
pSL12 - Brr2 del422 Q904E
Plasmid#90262Purposeprotein expressionDepositorInsertBRR2
TagsTAPExpressionYeastMutationdeleted first 422 amino acids and amino acid Q904EAvailabilityAcademic Institutions and Nonprofits only -
pSL13 - Brr2 del422 R1107L
Plasmid#90263Purposeprotein expressionDepositorInsertBRR2
TagsTAPExpressionYeastMutationdeleted first 422 amino acids and amino acid R110…AvailabilityAcademic Institutions and Nonprofits only -
pILGFP4K
Plasmid#104506PurposeUsed to evaluate the expression output of Saccharomyces paradoxus GAL1 promoter with yEGFP used as the reporter geneDepositorInsertSpGAL1 promoter-yEGFP
ExpressionYeastAvailabilityAcademic Institutions and Nonprofits only -
pILGFP4O
Plasmid#104510PurposeUsed to evaluate the expression output of Saccharomyces paradoxus GAL2 promoter with yEGFP used as the reporter geneDepositorInsertSpdGAL2 promoter-yEGFP
ExpressionYeastAvailabilityAcademic Institutions and Nonprofits only -
pILGFP4P
Plasmid#104511PurposeUsed to evaluate the expression output of Saccharomyces pastorianus GAL2 promoter with yEGFP used as the reporter geneDepositorInsertSptGAL2 promoter-yEGFP
ExpressionYeastAvailabilityAcademic Institutions and Nonprofits only -
pLenti-Lifeact-tdTomato
Plasmid#64048PurposeFluorescent reporter for F-actin labeling in living cellsDepositorInsertLifeact
UseLentiviralTagstdTomatoExpressionMammalianPromoterUbiquitinAvailable SinceJuly 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn1-DIO-Flpo
Plasmid#237222PurposeFor Cre-dependent expression of Flp recombinaseDepositorInsertFlpo recombinase
UseAAV and Cre/LoxExpressionMammalianPromoterhSynAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
UG75-PAH1-3HA
Plasmid#184761PurposePAH1 overexpression. Promotes the formation of diacylglycerol from phosphatidate. Uses antibiotic resistance marker hphMX6.DepositorAvailable SinceFeb. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS4333 yeTadA1.0-T7 RNAP
Plasmid#137735PurposepCS4333 CEN/ARS vector, PGAL1-yeTadA1.0-100AA linker-T7 RNAP-TCYC1, TRP1 selectable markerDepositorInsertyeTadA1.0-T7 RNAP
ExpressionBacterial and YeastMutationE366G (See depositor comment below)Available SinceJan. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
UG75-DGK1-3HA
Plasmid#184759PurposeDGK1 overexpression. Promotes the formation of phosphatidate from diacylglycerol. Uses antibiotic resistance marker hphMX6.DepositorAvailable SinceFeb. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYSD085
Plasmid#212922PurposeEncodes the HA-tagged 649 Stalk yeast surface display anchor protein as a Type 4a part to be used in the yeast secretion/display (YSD) extension of the MoClo yeast toolkit (YTK)DepositorInsert649 Stalk
ExpressionBacterialAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPMVAu8
Plasmid#98297PurposeEnhancing the upper-part mevalonate pathway; overexpressing codon-optimized Enterococcus faecalis mevalonate pathway genes under the control of consitutive promoters.DepositorInsertPRPL4A-EfmvaS-TEFM1-PRPL15A-EfmvaE -TEBS1
ExpressionYeastAvailable SinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pICH-roGFP2-ORP1
Plasmid#191677PurposeTi plasmid pICH86988 harbouring roGFP2-ORP1 for peroxide detection in plant cells.DepositorInsertredox(ro)GFP2-ORP1
UseBinary agrobacterium ti plasmidExpressionPlantPromoterCaMV 35SAvailable SinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHACK-GAL4>QF2(newHA1)
Plasmid#104873PurposeHACK Donor plasmids for converting GAL4 lines to QF2 lines using HACK method. Updated version of Addgene#80275 for easier cloning of insertsDepositorInsertT2A-QF2
UseCRISPRExpressionInsectAvailable SinceMarch 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB2312 (TEF1p-Cas9-CYC1t_kanMX)
Plasmid#83946PurposeCas9-carrying vector with kanMX markerDepositorInsertCas9
ExpressionYeastAvailable SinceOct. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-RNAPII-CTD wt #14-HA
Plasmid#160688PurposeExpression of GST-RNA Polymerase II C-terminal domain fusion protein. Contains 14 of the consensus heptapeptide repeats shown to be phosphorylated by Cdc2 kinase.DepositorInsertRNA Polymerase II CTD
ExpressionBacterialMutationC terminal domain onlyAvailable SinceNov. 19, 2020AvailabilityAcademic Institutions and Nonprofits only