We narrowed to 4,634 results for: HRE
-
Plasmid#110938PurposeOGDH ORF containing silent wobble mutations insensitive to corresponding shRNAsDepositorInsertOGDH wobble cDNA (OGDH Human)
UseLentiviralTagsExpressionMutation15 silent wobble mutations corresponding to three…PromoterSV40Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
p5E-gfap
Plasmid#75024PurposeCan be used to drive expression in zebrafish astrocytes.DepositorInsertglial fibrillary acidic protein promoter (gfap Zebrafish)
Use5' entry vector for multisite gateway three …TagsExpressionMutationPromotergfapAvailable SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-3xNLS-AausFP1
Plasmid#191096PurposeTo express a bright green FP to label eucaryotic cell nuclei. To be used in tissue-clearing methods and other fluorescent microscopy methodsDepositorInsert3xNLS-AausFP1
UseAAV and Synthetic BiologyTagsThree repeats of the nuclear localizzation seque…ExpressionMammalianMutationOptimized to Human codon usagePromoterCMV enhancer and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/hArf6(T27N)-HA
Plasmid#79426PurposeExpresses C-terminally HA-tagged Arf6(T27N) in mammalian cellsDepositorInsertArf6 (ARF6 Human)
UseTagsHAExpressionMammalianMutationchanged Threonine 27 to AsparaginePromoterAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
RCAS-Flag-BRAFV600E
Plasmid#126615PurposeRetroviral expression of Flag tagged human oncogenic BRAFV600EDepositorAvailable SinceJuly 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
3xflag-APEX2-LRRK2
Plasmid#164622PurposeExpresses LRRK2 tagged with APEX2 and 3xFLAGDepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
UseTagsEGFPExpressionMammalianMutationPromoterAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pInducer20 ALPK1 T237M
Plasmid#231586PurposeALPK1 gene mutated in position T237M (Pathogenic mutation in ROSAH syndrome) under control of a doxycycline-inducible promoterDepositorInsertALPK1 (ALPK1 Human)
UseLentiviralTags3X flagExpressionMammalianMutationchanged threonine 237 to MethioninePromoterdoxycyclineAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177345PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from Synapsin promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterSynapsinAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTH733-2µ-RLuc/maxCFLuc
Plasmid#40608DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
EF1a_MYC Thr58Ala_P2A_Hygro_Barcode
Plasmid#120513PurposeBarcoded lentiviral vector to express MYC Thr58Ala in mammalian cells under control of EF1a promoter. Barcoded for transcript detection in single cell RNA-seq.DepositorInsertMYC Thr58Ala (MYC Human)
UseLentiviralTagsExpressionMutationPoint mutation changing Threonine to Alanine at a…PromoterEF1aAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDN-T2dMFot
Plasmid#44558DepositorInsertsPTETREG promoter
rtetR-M2::FFF
UseSynthetic Biology; Expression regulator/reporterTagsExpressionYeastMutationCompared to rtTA, rtTA-M2 has S12G, E19G, A56P, D…PromoterPTETREGAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-LAP-KNL1-M3
Plasmid#115896PurposeUsed for expression of siRNA-resistant KNL1-M3 (modified codons 258 and 259) from the FRT site of FlpIn cells upon addition of doxycyclin.DepositorInsertKNL1-M3 (KNL1 Human)
UseTagsEYFPExpressionMammalianMutationFragment of KNL1 containing three KNL1 repeat seq…PromoterAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
BE3-NLS-NLS-P2A-BLAST
Plasmid#135348PurposeExpression of BE3 (Base editor generation three) with dual C-terminal NLS in a single operon encoding P2A blasticidine resistanceDepositorInsertBE3-2XNLS
UseCRISPRTagsExpressionMammalianMutationWTPromoterAvailable SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 A82V/T230A/D637G 2014 EBOV + Mucin-Like Domain
Plasmid#86020PurposeEbola Virus (Makona) Glycoprotein in CMV driven mammalian expression vectorDepositorInsertMakona Ebola Virus Glycoprotein
UseTagsExpressionMammalianMutationChanged alanine 82 to valine, threonine 230 to al…PromoterCMV IEAvailable SinceJan. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 T230A 2014 EBOV Delta-Mucin-Like-Domain
Plasmid#86023PurposeEbola Virus (Makona) Glycoprotein in CMV driven mammalian expression vectorDepositorInsertMakona Ebola Virus Glycoprotein
UseTagsExpressionMammalianMutationLacks mucin-like domain: Changed threonine 230 to…PromoterCMV IEAvailable SinceJuly 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 A82V/T230A 2014 EBOV Delta-Mucin-Like-Domain
Plasmid#86025PurposeEbola Virus (Makona) Glycoprotein in CMV driven mammalian expression vectorDepositorInsertMakona Ebola Virus Glycoprotein
UseTagsExpressionMammalianMutationLacks mucin-like domain; Changed alanine 82 to va…PromoterCMV IEAvailable SinceJuly 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1-SP-ALFA-lk-HiBiT-lk-ADGRL3-T923G
Plasmid#233063PurposeExpresses cleavage-deficient mouse ADGRL3-T923G (UniProt Q80TS3-3). An N-terminal AFLA-tag (SRLEEELRRRLTE) and HiBiT tag (VSGWRLFKKIS) follow the endogenous ADGRL3 signal peptide.DepositorInsertADGRL3 (Adgrl3 Mouse)
UseTagsALFA and HiBiTExpressionMammalianMutationThreonine 923 to GlycinePromoterAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBiFC-SS-VN155(I152L)-IRE1-dLD
Plasmid#217752PurposeExpresses the VN fragment of BiFC-IRE1-dLDDepositorInsertSerine/threonine-protein kinase/endoribonuclease IRE1 (ERN1 Human)
UseTagsVenus (1-154, I152L)ExpressionMammalianMutationdeleted amino acids 29-408PromoterAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC131: pAAV.CMV-CasRx-VEGFA sgRNA array
Plasmid#203444PurposePlasmid expressing active RfxCas13d with an array of three VEGFA mRNA targeting gRNAsDepositorInsertsU6-VEGFA sgRNA array
RfxCas13d
UseAAVTagsHA and NLSExpressionMammalianMutationPromoterCMV and U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only