We narrowed to 4,534 results for: ARA-2
-
Plasmid#214280PurposeExpress split-Rac1 fragments that are fused with CIDs and FPsDepositorInsertsTagsmCerulean (on insert 1) and mVenus (on insert 2)ExpressionMammalianMutationRac1-Q61LPromoterCMVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pIRES-mCerulean-FRB-Rac1/N12-Rac1/13C(T17N)-FKBP-mVenus-CAAX
Plasmid#214281PurposeExpress split-Rac1 fragments that are fused with CIDs and FPsDepositorInsertsTagsmCerulean (N terminal on insert 1) and mVenus (onā¦ExpressionMammalianMutationRac1-T17NPromoterCMVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRES-mCerulean-FRB-RhoA/N12-RhoA/13C(T19N)-FKBP-mVenus-CAAX
Plasmid#214283PurposeExpress split-RhoA fragments that are fused with CIDs and FPsDepositorInsertsTagsmCerulean (N terminal on insert 1) and mVenus (onā¦ExpressionMammalianMutationRhoA-T19NPromoterCMVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_NUP98_NSD1
Plasmid#205873PurposeExpress mEGFP-tagged fusion protein, NUP98_NSD1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 hMOG-alpha2-EGFP
Plasmid#160976PurposeExpresses a human myelin oligodendrocyte glycoprotein isoform alpha2 - EGFP fusion protein in mammalian cellsDepositorInsertHomo sapiens myelin oligodendrocyte glycoprotein (MOG), transcript variant alpha2 (MOG Human)
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 hMOG-beta2-EGFP
Plasmid#160979PurposeExpresses a human myelin oligodendrocyte glycoprotein isoform beta2 - EGFP fusion protein in mammalian cellsDepositorInsertHomo sapiens myelin oligodendrocyte glycoprotein (MOG), transcript variant beta2 (MOG Human)
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 3xFlag
Plasmid#110063PurposeFGFR2 expression in mammalian cells (JCOPCO paper)DepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationnonePromoterCMVAvailable SinceDec. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 F276C 3xFlag
Plasmid#110064PurposeFGFR2 F276C expression in mammalian cells (JCOPO paper)DepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationmutated Phenylalanine 276 to Cysteine (F276C)PromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
FGFR2 K41E 3xFlag
Plasmid#110105Purposeexpresses FGFR2 with a single amino acid change in mammalian cellsDepositorInsertfibroblast growth factor receptor 2 (FGFR2 Human)
TagsFlagExpressionMammalianMutationmutated Lysine 41 to Glutamic acid (K41E)PromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-TO-hNGN2
Plasmid#172115PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into glutamatergic neurons via NGN2 expressionInsertsTagsT2A-mycNLS-mTagBFP2ExpressionMammalianPromoterEF1a and TRE3GAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKT-IDH1(R132H)-IRES-Katushka
Plasmid#124257PurposeExpresses IDH1 with a R132H mutation and katushka fluorescent reporter. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertIsocitrate dehydrogenase 1 (R132H) (IDH1 Human)
ExpressionMammalianMutationArginine 132 is mutated to Histidine. This mutatiā¦Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB-TO-hNIL
Plasmid#172113PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into lower motor neurons via NGN2, ISL1, and LHX3 expressionTagsT2A-mycNLS-mTagBFP2ExpressionMammalianPromoterEF1a and TRE3GAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only