We narrowed to 22,466 results for: lentiviral
-
Plasmid#144689PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only
-
TFORF0683
Plasmid#142675PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0532
Plasmid#143710PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3511
Plasmid#144987PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7751 pHR Ef1α: mCherry-P2A-AcrIIA4
Plasmid#125148PurposeLentiviral vector for constitutive expression of AcrIIA4 with mCherry fluorescent reporter.DepositorInsertAcrIIA4-P2A-mCherry
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMay 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
TFORF0199
Plasmid#141551PurposeLentiviral vector for overexpressing the RFX2 transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSin-GFP-Fg
Plasmid#174307PurposeLentiviral expression of GFPDepositorAvailable SinceSept. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-mTurquoise-MLC-IRES-neo
Plasmid#85145Purposelentiviral expression of myosin light chain (MLC, MYL9), N-terminally tagged with mTurquoiseDepositorInsertmTurquoise-MLC (myosin regulatory light chain, N-terminally tagged with mTurquoise (MYL9 Human)
UseLentiviralTagsmTurquoisePromoterEF1aAvailable SinceFeb. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
TFORF1971
Plasmid#144318PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
NgΔIQ FUNgDIQGW
Plasmid#92232PurposeLentiviral expression of human Ng with deletion mutationDepositorInsertNg (NRGN Human)
UseLentiviralTagsEGFPExpressionMammalianMutationdelta IQPromoterhUbCAvailable SinceMarch 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
MLKL gRNA (BRDN0001148608)
Plasmid#77539Purpose3rd generation lentiviral gRNA plasmid targeting human MLKLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TFORF0672
Plasmid#141658PurposeLentiviral vector for overexpressing the ZNF827 transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3483
Plasmid#144959PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
MLKL gRNA (BRDN0001146456)
Plasmid#77540Purpose3rd generation lentiviral gRNA plasmid targeting human MLKLDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLX317-hcRED
Plasmid#115440PurposeConstitutive lentiviral expressionDepositorInserthcRED
UseLentiviralTagsV5ExpressionMammalianPromoterEF1aAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
TFORF1418
Plasmid#143803PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2676
Plasmid#142355PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mCherry
Plasmid#209035PurposeLentiviral backbone for expressing U6 driven hybrid guide (hg)RNAs with BveI cloning sites, mCherry and puromycin selection markerDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOUPc-UL148-mCherry
Plasmid#179279PurposeAll in one "tet-on" lentivirus vector that expresses human cytomegalovirus UL148 fused to an mCherry tag at its cytoplasmic tail. UL148 reorganizes the ER and activates the UPR.DepositorInsertUL148 fused to mCherry
UseLentiviral; Tet-on, all-in-one lentiviral vectorTagsmCherryExpressionMammalianPromoterTet responsive element 3GAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only