We narrowed to 7,089 results for: CAD
-
Plasmid#211896PurposeVinculin (chicken) with S1033 unphosphorylatable point mutation (S1033A) tagged with VenusA206K at the C-terminus, in lentiviral expression vector.DepositorInsertVinculinVenus-S1033A (VCL Chicken)
UseLentiviralTagsVenusA206KMutationmutated vinculin serine 1033 to alanine (S1033A),…PromoterCMVAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL-VinculinVenus-S1033D
Plasmid#211897PurposeVinculin (chicken) with S1033 phosphomimetic point mutation (S1033D) tagged with VenusA206K at the C-terminus, in lentiviral expression vector.DepositorInsertVinculinVenus-S1033D (VCL Chicken)
UseLentiviralTagsVenusA206KMutationmutated vinculin serine 1033 to aspartic acid (S1…PromoterCMVAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
SNAP-MIDAS
Plasmid#171604PurposeExpresses the SNAP-tagged MIDAS domain of S. pombe Mdn1 (a.a. 4381-4717) in bacteria.DepositorInsertMIDAS domain of S. pombe Mdn1 (a.a. 4381-4717)
TagsHis6 tag and SNAP tagExpressionBacterialAvailable SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCV FLIP p53
Plasmid#19745DepositorAvailable SinceDec. 18, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCru5-/GCCACC-mEGFP-IRES-mCherry
Plasmid#49226PurposeRetroviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseRetroviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterViral LTR (or CMV)Available SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSLIK-Neo-TmiR-Luc
Plasmid#25743PurposeControl lentiviral vector with Tet-based inducible expression of Luciferase miR30-based shRNA, constitutive Neomycin resistance gene coexpression.DepositorInsertLuciferase miR-shRNA
UseLentiviral and RNAiExpressionMammalianAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pWPT-/CGA-mEGFP-IRES-mCherry
Plasmid#49233PurposeLentiviral expression vector. Contains an altered Kozak sequence and/or upstream open reading frames to modulate expression at the level of translation.DepositorInsertsmEGFP
mCherry
UseLentiviral and Synthetic BiologyTagsSfuI site to create C-terminal fusionsExpressionMammalianPromoterEF1-shortAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCsy3-VPR-Csy4
Plasmid#153943PurposeExpresses type I-F P. aeruginosa cascade (PaeCascade) proteins Csy3-VPR and Csy4 in mammalian cellsDepositorInsertCsy3-VPR, Csy4
UseAAV and CRISPRExpressionMammalianPromoterCMVAvailable SinceAug. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCsy1-Csy2
Plasmid#153942PurposeExpresses type I-F P. aeruginosa cascade (PaeCascade) proteins Csy1 and Csy2 in mammalian cellsDepositorInsertCsy1, Csy2
UseAAV and CRISPRTagsFlagExpressionMammalianPromoterCMVAvailable SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pco-nCASphi_E9t_V2_pUB10_E9t_ribozyme_AtPDS3_gRNA10
Plasmid#197981PurposeT-DNA binary vector to express pco-nCasphi driven by UBQ10 gene promoter, and the AtPDS3 guide RNA 10 driven by UBQ10 gene promoter, flanked by ribozymes.DepositorInsertspco-nCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterpUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBacPAK8-His-myc-Rbx1
Plasmid#29506DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 PARL-FLAG-CT S65D+T69D+S70D
Plasmid#13617DepositorTagsFLAGExpressionMammalianMutationchanged Serine 65, Thr 69 and Ser70 to AspAvailable SinceJan. 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pRvCAHS1-mEGFP-NLS
Plasmid#205013PurposeThe vector contains 1kbp of the upstream and downstream regions of the cahs1 gene from Ramazzottius varieornatus, with the mEGFP gene with NLS sequence positioned in between.DepositorInsertmEGFP-NLS flanked by 1kbp upstream and downstream of the cahs1 gene from Ramazzottius varieornatus
UseTardigrade expressionAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRvSAHS1-mCherry-NLS
Plasmid#205009PurposeThe vector contains 1kbp of the upstream and downstream regions of the sahs1 gene from Ramazzottius varieornatus, with the mCherry gene with NLS sequence positioned in between.DepositorInsertmCherry-NLS flanked by 1kbp upstream and downstream of the sahs1 gene from R. varieornatus
UseTardigrade expressionAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-CHD7 (1-1899)
Plasmid#170143PurposeExpresses residues 1-1899 of CHD7 in insect cellsDepositorInsertchromodomain helicase DNA binding protein 7 (CHD7 Human)
TagsFLAGExpressionInsectMutationC-terminal truncation of residues 1900-2997Available SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-CHD7 (1-1547)
Plasmid#170144PurposeExpresses residues 1-1547 of CHD7 in insect cellsDepositorInsertchromodomain helicase DNA binding protein 7 (CHD7 Human)
TagsFLAGExpressionInsectMutationC-terminal truncation of residues 1548-2997Available SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-CHD7 (K999R)
Plasmid#170142PurposeExpresses CHD7 (K999R) in insect cellsDepositorInsertchromodomain helicase DNA binding protein 7 (CHD7 Human)
Tags6xHis and FLAGExpressionInsectMutationK999RAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOPS0380
Plasmid#133230PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with constitutive promoter Rlv3841pnifH (pOGG082), mCherry (EC15071) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
p7612 MSCV-P C-FlagHA 16E7 E10K
Plasmid#163303PurposeExpresses HPV16 E7 E10KDepositorInsertHPV16 E7 E10K
UseRetroviralTagsFlagHAMutationE10KPromoterMSCV LTRAvailable SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only