We narrowed to 4,650 results for: HRE
-
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Tet-MKK6(DD)-Puro
Plasmid#86094PurposeTet/Dox inducible (TetR) constitutively active mutant MKK6/MAP2K6 in lentiviral vectorDepositorInsertMKK6 (MAP2K6 Human)
UseLentiviralTagsMyc tagExpressionMammalianMutationSerine 207 and Threonine 211 both changed to Aspa…PromoterCMV/TetOAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMG071 MBP-GSK3β_S9A-HA-His, GST_λPPase
Plasmid#196185PurposeCo-expresses MBP-GSK3β_S9A-HA-His (human GSK3β with S9A mutation as a fusion protein with MBP, HA, and His-tags) and GST_λPPase in E.coli to produce unphosphorylated MBP-GSK3β_S9A-HA-HisDepositorInsertsTagsGST, HA, His6, and MBPExpressionBacterialMutationchanged Serine 9 to AlaninePromoterTacAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBridge-tyrosinase.σ1A
Plasmid#197381PurposeExpression of 1) GAL4 DNA-binding domain (BD)-tyrosinase cytosolic tail fusion protein, 2) HA epitope and nuclear localization signal (NLS) AP-1 σ1A fusion protein in yeast (yeast three-hybrid assays)DepositorInsertstyrosinase cytosolic tail
AP-1 σ1A
TagsGAL4-DNA binding domain fragment, HA tag, and SV4…ExpressionYeastMutationContains an extra 42 nucleotides encoding 14 resi…PromoterADH1 and MET25Available SinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTH734-2µ-RLuc/stopCFLuc
Plasmid#40609DepositorInsertsFirefly Luciferase (nonsense mutant)
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
Flag-KLF6-4D (1054)
Plasmid#49490Purposeexpresses human Flag tagged KLF6 with 4D mutationDepositorInsertKFL6-4D (KLF6 Human)
TagsFlagExpressionMammalianMutationthree serines and one tyrosine mutated to aspart…PromoterCMVAvailable SinceFeb. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
RKF1 X030_pECIA14
Plasmid#114856PurposePrey vector RKF1 X030_pECIA14 should be used with bait vector RKF1 X030_pECIA2.DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23 A82V/T230A/D637G 2014 EBOV Delta-Mucin-Like-Domain
Plasmid#86026PurposeEbola Virus (Makona) Glycoprotein in CMV driven mammalian expression vectorDepositorInsertMakona Ebola Virus Glycoprotein
ExpressionMammalianMutationLacks mucin-like domain; Changed alanine 82 to va…PromoterCMV IEAvailable SinceJuly 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTH752-CEN-RLuc/min103maxCFLuc
Plasmid#38218DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 103 codons of the original FLuc gene we…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH751-CEN-RLuc/min53maxCFLuc
Plasmid#38217DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 53 codons of the original FLuc gene wer…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMAPLe4 PCMTD1 T62 H67 M68
Plasmid#246506PurposeRecombinant protein expression of PCMTD1 T62 H67 M68DepositorInsertProtein-L-isoaspartate O-methyltransferase domain-containing protein 1 (PCMTD1 Human)
TagsHis-tagExpressionBacterialMutationResidue 312 is Isoleucine in this plasmid but occ…Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-BRAF_WT&Mut-SM
Plasmid#215916PurposeThis plasmid encodes luciferase which has siRNA binding sites in 3'UTR for detecting the siRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of siBRAF_WT&Mut (BRAF Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-BRAF_WT-SM
Plasmid#215917PurposeThis plasmid encodes luciferase which has siRNA binding sites in 3'UTR for detecting the siRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of siBRAF_ WT (BRAF Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-BRAF_Mut1-SM
Plasmid#215918PurposeThis plasmid encodes luciferase which has siRNA binding sites in 3'UTR for detecting the siRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of siBRAF_ Mut1 (BRAF Human)
ExpressionMammalianMutationBRAFAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-BRAF_Mut2-SM
Plasmid#215919PurposeThis plasmid encodes luciferase which has siRNA binding sites in 3'UTR for detecting the siRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of siBRAF_ Mut2 (BRAF Human)
ExpressionMammalianMutationBRAFAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
CamKII-LGI1-T380A-pHluorin
Plasmid#185543PurposeExpresses mutant T380A LGI1-pHluorin under the CamKII promoterDepositorInsertLGI1 (Lgi1 Rat)
UseLentiviralTagspHluorinExpressionMammalianMutationchanged threonine 380 for alaninePromoterCamKIIAvailable SinceMay 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBabe 3XFLAG-S/T3A-GATA6-3XAU1 puro
Plasmid#72611PurposeFor mammalian expression of an N-terminally triple FLAG-tagged and C-terminally triple AU1-tagged full length human GATA6 with triple alanine mutations on aminoacids#33,#34 and #37DepositorInsertGATA binding protein 6 (GATA6 Human)
UseRetroviralTags3XAU1 and 3XFLAGExpressionMammalianMutationchanged serine33, threonine34 and serine37 to ala…Available SinceFeb. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTH748-CEN-RLuc/min8maxCFLuc
Plasmid#38214DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first eight codons of the original FLuc gene …PromoterADH1 and TDH3 (=GDP)Available SinceNov. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH753-CEN-RLuc/min346maxCFLuc
Plasmid#38219DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 346 codons of the original FLuc gene we…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only