We narrowed to 4,634 results for: HRE
-
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
UseTagsEGFPExpressionMammalianMutationE167DPromoterAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBabe 3XFLAG-S/T3A-GATA6-3XAU1 puro
Plasmid#72611PurposeFor mammalian expression of an N-terminally triple FLAG-tagged and C-terminally triple AU1-tagged full length human GATA6 with triple alanine mutations on aminoacids#33,#34 and #37DepositorInsertGATA binding protein 6 (GATA6 Human)
UseRetroviralTags3XAU1 and 3XFLAGExpressionMammalianMutationchanged serine33, threonine34 and serine37 to ala…PromoterAvailable SinceFeb. 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTH748-CEN-RLuc/min8maxCFLuc
Plasmid#38214DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationThe first eight codons of the original FLuc gene …PromoterADH1 and TDH3 (=GDP)Available SinceNov. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH753-CEN-RLuc/min346maxCFLuc
Plasmid#38219DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationThe first 346 codons of the original FLuc gene we…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH747-CEN-RLuc/min4maxCFLuc
Plasmid#38213DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationThe first four codons of the original FLuc gene w…PromoterADH1 and TDH3 (=GDP)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
Lenti-LucA
Plasmid#174047PurposeExpresses mALG8 (ITYTWTRL) antigen as a fusion to luciferase and Cre recombinaseDepositorInsertLucA
UseCre/Lox, Lentiviral, and LuciferaseTagsLuciferaseExpressionMammalianMutationALG8 alanine 506 to threoninePromoterHuman Ubiquitin CAvailable SinceAvailabilityAcademic Institutions and Nonprofits only -
pGEMT-TPE2A-Mef2c-Tdtomato-Gata4-Tbx5
Plasmid#111818PurposeQuadcistronic construct: Co-express four genes by three 2A peptides -- T2A, P2A and E2ADepositorUseCloning intermediateTagsExpressionMutationPromoterAvailable SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pC0054-CMV-dPspCas13b-longlinker-ADAR2DD(E488Q/T375G)
Plasmid#103870PurposeHigh specificity version of dPspCas13b-ADAR2DD(E488Q) fusions. T375G mutation in the ADAR deaminase domain confers increased specificity with slightly reduced activity.DepositorInsertsUseCRISPRTagsGSGGGGS and HIV NESExpressionMammalianMutationChanged histidne 133 to alanine and histidine 105…PromoterAvailable SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-hCCND1-T2A-hCCND2-P2A-hCCND3
Plasmid#174156PurposeLentiviral vector expressing all three D-type cyclins (cyclin D1, cyclin D2, cyclin D3) from a single promoterDepositorInsertCCND1>T2A>CCND2>P2A>CCND3
UseLentiviralTagsExpressionMammalianMutationPromoterEF1AAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
CS2 Flag-Smad2 (3A)
Plasmid#101763PurposeExpresses SMAD2 (3A) in mammalian cellsDepositorInsertSMAD2 (SMAD2 Human)
UseTagsFlagExpressionMammalianMutationThree Ser to Ala mutations in the phosphorylation…PromoterCMVAvailable SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHEE2E-TRI
Plasmid#71288PurposeEgg cell-specific promoter-controlled expression 3×FLAG-NLS-zCas9-NLS and two sgRNAs targeting three genes: ETC2, TRY, and CPCDepositorInsertssgRNA targeting TRY and CPC genes
sgRNA targeting ETC2 gene
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 enhancer fused to EC1.1 promoter and U6-26p…Available SinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-STK32C
Plasmid#23720DepositorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pPaGE Pyl TAG FliC T248TAG
Plasmid#160089PurposeEncodes for MmPyl tRNA synthetase/tRNA pair and for flagellin protein (FliC) with TAG mutation at site 248, for unnatural amino acid incorporation into the flagellin protein in Pseudomonas aeruginosa.DepositorInsertsPyrrolysyl tRNA(cua) (Methanosarcina mazei)
Pyrrolysyl tRNA synthetase (Methanosarcina mazei)
Flagellin
UseSynthetic BiologyTagsExpressionBacterialMutationChanged Threonine 248 to TAG stop-codon.PromoterPseudomonas aeruginosa Leu-tRNA native promoter a…Available SinceJune 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-STK11
Plasmid#23802DepositorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCAG-2dV-Camui (T305D/T306D)
Plasmid#220368PurposeT305D/T306D phosphomimetic mutant of pCAG-2dV-CamuiDepositorInsertmVenus(Y145W)-mVenus(Y145W)-rat CaMK2 alpha(T305D/T306D)-mEGFP(A206K) (Camk2a Rat, Synthetic)
UseTagsmEGFP(A206K) and mVenus(Y145W)-mVenus(Y145W)ExpressionMammalianMutationchanged both Threonine 305 and 306 to aspartic ac…PromoterCAGAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-RIPK2
Plasmid#23846DepositorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-STK38
Plasmid#23811DepositorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
EK0438 SFFV-mCherry-SGc(s70587)cSG-EGFP-(3xMS2) (FLP-IN)
Plasmid#191163PurposeExpression of a sensor for synthetic sequence 1 (EK0208) with three MS2 sequences in the 3' UTR in mammalian cells. Compared to EK0285, also has additional restriction sites around the sensor sequence. Recommended for the basis for cloning new sensors for use with MCP-ADAR(DD). HindIII & MluI can be used to swap out marker (mCherry). (KpnI or BamHI) and (BshTI or BcuI) can be used to swap out sensor sequence (s70587). XhoI and ApaI can be used to swap out output (EGFP).DepositorInsertmCherry:s70587:EGFP-3xMS2
UseTagsExpressionMammalianMutationWTPromoterSFFVAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pWZL Neo Myr Flag MKNK1
Plasmid#20536DepositorAvailable SinceOct. 27, 2009AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-STK24
Plasmid#23595DepositorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only