We narrowed to 24,925 results for: crispr
-
Plasmid#189929PurposePlasmid encoding CjABE8e driven by the CMV promoter for plasmid transfection.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCjABE8e
ExpressionMammalianMutationCjCas9 D8APromoterCMVAvailable sinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJW2171
Plasmid#163095PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertionDepositorInsert30aa linker::mNeonGreen (dpi)::AID*::3xFLAG::10aa linker
UseCRISPRExpressionWormMutationSilent mutations to remove piRNA sitesAvailable sinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
ABE8.20-d
Plasmid#136301Purposeexpresses ABE8.20-d in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertABE8.20-d
TagsC-terminal BPNLSExpressionMammalianMutationD10A in S. pyogenes Cas9, TadA mutations describe…PromoterCMVAvailable sinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSH-EFIRES-P-Seipin-miniIAA7-3XFlag
Plasmid#129722PurposeAAVS1 safe harbor targeting vector expressing miniIAA7-3XFlag tagged SeipinDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSeipin (BSCL2 Human)
UseCRISPR and TALEN; Human safe harbor locus (a avs1…TagsminiIAA7-3XFlagExpressionMammalianMutationsilent mutationsPromoterEF1aAvailable sinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGGDestTol2LC-3sgRNA
Plasmid#64241Purposedestination vector for three U6x:sgRNA cassettesDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 5, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGGDestTol2LC-2sgRNA
Plasmid#64240Purposedestination vector for two U6x:sgRNA cassettesDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDD315 (mTurquoise2^SEC^2xHA)
Plasmid#73343PurposemTurquoise2^SEC^2xHA vector with ccdB sites for cloning homology armsDepositorInsertmTurquoise2-C1^SEC^3xFlag
UseCRISPR and Cre/LoxTags2xHA and C. elegans codon-optimized mTurquoise2ExpressionWormAvailable sinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
hRad51(A89E)–Cas9(D10A)
Plasmid#125563PurposeExpresses the Rad51(A89E)–Cas9(D10A) fusion construct in mammalian cells under CMV promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRad51(A89E)–Cas9(D10A) (RAD51 Human)
UseCRISPRExpressionMammalianAvailable sinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-50: NPM1-mEGFP
Plasmid#109122PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human NPM1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNPM1 Homology Arms with linker-mEGFP (NPM1 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available sinceMay 4, 2018AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pCBh_NLS_dCas13X_NLS-pA-U6-DR-BpiI-BpiI-DR-pSV40-EGFP-pA-pSV40-mCherry-pA
Plasmid#191796Purposevector for encoding a human codon-optimized dead Cas13X (dCas13X) driven by CBh promoter, guide RNAs compatible with Cas13X driven by hU6, EGFP driven by SV40 promoter, and mCherry driven by SV40 promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthumanized dCas13X
UseCRISPRExpressionMammalianMutationR84A, H89A, R739A, R740A, H745A, H746A, H747APromoterCBh, SV40, hU6Available sinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiRCas9-CUG
Plasmid#104183PurposeLentiviral transfer vector that carries U6-driven sgRNA targeting CUG repeats using a modified scaffold (Chen et al. Cell 2013) and CMV-driven PIN-dCas9. Derived from LentiCRISPR v2 (Zhang lab)DepositorInsertU6-CUGsgRNA, EFS-PIN-dCas9
UseCRISPR and LentiviralAvailable sinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDGE792
Plasmid#167300PurposeVector for plant genome editing containing pRPS5a:GFP-Cas9 expression cassette, Bar (BASTA/PPT) selection marker, and FCY-UPP and Ca-Bs3 counterselction markers, but not sgRNAs.DepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable sinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
BLADE-182
Plasmid#134914PurposesgRNA targeting GFP to be used in nanoblade systemDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGFP
UseCRISPR and Synthetic BiologyPromoterU6Available sinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAWG-dCas9-VPR
Plasmid#63802PurposeSP-dCas9 with VP64-p65-Rta (VPR) fused to it's C-terminus; drosophila vectorDepositorInsertSP-dCas9-VPR
UseCRISPR and Synthetic BiologyTagsVPR (VP64-p65-Rta)ExpressionInsectPromoteract5cAvailable sinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMK391 (mAID-BSD)
Plasmid#121192PurposeC-terminal taggingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmAID-BSD
UseCRISPRAvailable sinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AICSDP-28:TUBA1B-mTagRFP-T
Plasmid#101785PurposeHomology arms and mTagRFPT-linker sequence for N-terminus (second exon) tagging of human TUBA1BDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTUBA1B Homology Arms with mTagRFPT-linker (TUBA1B Human)
UseCRISPR; Donor templateTagsmTagRFPT-linkerExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available sinceOct. 31, 2017AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
7b sgRNA for EJ7-GFP reporter
Plasmid#113624PurposesgRNA/CAS9 expression plasmid to induce the 3’ double-strand break in the EJ7-GFP reporterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsert7b sgRNA
UseCRISPRExpressionMammalianAvailable sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by