We narrowed to 13,335 results for: ache
-
Plasmid#59255PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt80-ex5-7
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X34
Plasmid#59258PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt81-ex9 and 3' UTR
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X38
Plasmid#59262PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt83-ex3-4
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X40
Plasmid#59264PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt84-ex1
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X41
Plasmid#59265PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt84-ex5-6
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X45
Plasmid#59269PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsert1700011A15Rik-ex3-5 and 3' UTR
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-INT2
Plasmid#59287PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intronic region of the keratin type II cluster.DepositorInsertkrt80-Intron 4
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-X3
Plasmid#59227PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the exonic region of the keratin type II cluster.DepositorInsertKrt4-ex7-9
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUK21
Plasmid#49788PurposeE. coli cloning vector (KanR, high copy, blue/white selection, M13 IR)DepositorTypeEmpty backboneUseCloning vectorPromoterlacZAvailable SinceJuly 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn_GCaMP6m_sWPRE_spA_mDLX_nls_mRuby3_ssWPRE_spA
Plasmid#205281PurposeCaMP used to measuring calcium changes in neurons, while nls-mRuby is employed to specifically identify cortical GABAergic neurons. This dual labeling approach allows for the simultaneous observation of neuronal activity using GCaMP and the identification of a specific subset of neurons using nls-mRuby, focusing specifically on cortical GABAergic neurons.DepositorInsertGCaMP6s
UseAAVAvailable SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJS102
Plasmid#118281PurposeExpresses GFPmut2 with low cell-to-cell variation and lactose inductionDepositorInsertGFPmut2
ExpressionBacterialPromoterpLlacO-1Available SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a MDHC_YEAST
Plasmid#204232PurposeBacterial expression of yeast cytosolic malate dehydrogenase; Use in CURES (integration of research into undergraduate teaching labs).Available SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOK12
Plasmid#49789PurposeE. coli cloning vector (KanR, low copy, blue/white selection)DepositorTypeEmpty backboneUseCloning vectorPromoterlacZAvailable SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSecUAG_UTu1D
Plasmid#233867PurposeExpresses machinery necessary for selenocysteine incorporation at UAG codons in BL21-derived cells, spectinomycin resistantDepositorInsertsallo-tRNA UTu1D
thioredoxin
Selenophosphate synthase
Selenocysteine synthase
ExpressionBacterialMutationCysteine 32 switched to Selenocysteine (UAG) and …PromoterEM7, araBAD, and native As SelDAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
TBXTA-c028
Plasmid#139765PurposeProtein expression/Streptavidin pull-downDepositorInsertTBXT, Full-length, WT (TBXT Human)
TagsAvi-tag (Biotin) and His6-GST-TEVExpressionBacterialMutationContains only amino acids S2- M435PromoterT7Available SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCaryP
Plasmid#18945DepositorInsertphiC31 attP
ExpressionInsectAvailable SinceOct. 27, 2008AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-huKC2-IGR21
Plasmid#59456PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the human keratin type II cluster.DepositorInserthuKrt1 3’intergenic region
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
TBXTA-c043
Plasmid#139766PurposeProtein expression/Streptavidin pull-downDepositorInsertTBXT, DNA-binding domain, WT (TBXT Human)
TagsAvi-tag (Biotin) and His6-TEVExpressionBacterialMutationContains only amino acids E41- D225PromoterT7Available SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET24a MDHC1_ARATH
Plasmid#204237PurposeBacterial expression of Arabidopsis cytosolic malate dehydrogenase; Use in CURES (integration of research into undergraduate teaching labs).Available SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEx_MCS-attBtagRFPt
Plasmid#48876PurposePhiC31 exchange vector with multiple cloning site, exchange of EGFP in landing site with tagRFPtDepositorTypeEmpty backboneUseUnspecifiedAvailable SinceDec. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
TBXTA-c027
Plasmid#139764PurposeProtein expression/Streptavidin pull-downDepositorInsertTBXT, Full-length, G177D (TBXT Human)
TagsAvi-tag (Biotin) and His6-GST-TEVExpressionBacterialMutationG177D; contains only amino acids S2- M435PromoterT7Available SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSB_PhiC31LandingSite
Plasmid#48875PurposeSleeping beauty transposon with the PhiC31 landing site in a cmlc2::EGFP selection cassetteDepositorInsertcmlc2::attP-EGFP
Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET28a MDH_PFALCI
Plasmid#204235PurposeBacterial expression of unicellular protozoan parasite P. falciparum malate dehydrogenase; Use in CURES (integration of research into undergraduate teaching labs).InsertMDH_PFALCI (PF3D7_0618500 Plasmodium falciparum)
Tags6X HisExpressionBacterialPromoterLacAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
TBXTA-c044
Plasmid#139767PurposeProtein expression/Streptavidin pull-downDepositorInsertTBXT, DNA-binding domain, G177D (TBXT Human)
TagsAvi-tag (Biotin) and His6-TEVExpressionBacterialMutationG177D; contains only amino acids E41- D225PromoterT7Available SinceMay 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEx_Hsp70::attBmut
Plasmid#48878PurposePhiC31 exchange vector with the Hsp70 promoter driving tagRFPt from the landing site. Template for enhancer tests.DepositorTypeEmpty backboneAvailable SinceDec. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHH0103 APBB2 WW domain
Plasmid#104257PurposeBacterial expression of WW domain from APBB2DepositorInsertAPBB2 WW domain (APBB2 Human)
TagsGSTExpressionBacterialMutationcodon optimized for expression in bacteriaPromotertacAvailable SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muEDC-Int3
Plasmid#59288PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intronic region of the mouse Epidermal Differentiation Complex.DepositorInsertmFlg int-Intron 1
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pET24a MDH_HALMA
Plasmid#204241PurposeBacterial expression of H. marismortui (Dead Sea halophilic red archaeon) cytosolic malate dehydrogenase; Use in CURES (integration of research into undergraduate teaching labs).Available SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hCASP8
Plasmid#185378PurposeFor mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)DepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
TBXTA-c024
Plasmid#139761PurposeProtein expression/GST pull-downDepositorInsertTBXT, DNA-binding domain, G177D (TBXT Human)
TagsHis6-GST-TEVExpressionBacterialMutationG177D; contains only amino acids E41-D225PromoterT7Available SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-IGR4
Plasmid#59273PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the keratin type II cluster.DepositorInsertIntergenic 3kb downstream Krt82
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-IGR7
Plasmid#59276PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the keratin type II cluster.DepositorInsertintergenic 4kb upstream krt1
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-IGR8
Plasmid#59277PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the keratin type II cluster.DepositorInsertIntergenic 2kb downstream krt79
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-IGR1
Plasmid#59270PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the keratin type II cluster.DepositorInsertIntergenic 20kb downstream krt80
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muEDC-IGR15
Plasmid#59283PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the mouse Epidermal Differentiation Complex.DepositorInsertmLor-IGR2-3_nn79710
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-IGR2
Plasmid#59271PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the keratin type II cluster.DepositorInsertIntergenic 10kb upstream krt80
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-huKC1-IGR19
Plasmid#59285PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the human keratin type I cluster.DepositorInsert9kb upstream hKrt14-1700
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-IGR6
Plasmid#59275PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the keratin type II cluster.DepositorInsertintergenic 11kb upstream krt2
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-IGR3
Plasmid#59272PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the keratin type II cluster.DepositorInsertIntergenic 4kb downstream Gm6042
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV-Enh eGFP Reporter-muKC2-IGR11
Plasmid#59280PurposeLentiviral GFP reporter for testing enhancer activity in different cell types. Insert is an enhancer identified in the intergenic region of the keratin type II cluster.DepositorInsertIntergenic 2kb upstream krt18
UseLentiviralPromoterMu Hsp68 minimal promoterAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Casp8
Plasmid#11817DepositorInsertCaspase 8 (CASP8 Human)
ExpressionMammalianAvailable SinceMay 25, 2006AvailabilityAcademic Institutions and Nonprofits only -
pHH0103 YAP1 WW domain #2
Plasmid#104228PurposeBacterial expression of WW domain #2 from YAP1DepositorInsertYAP1 WW domain #2 (YAP1 Human)
TagsGSTExpressionBacterialMutationcodon optimized for expression in bacteriaPromotertacAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103 YAP1 WW domain #1
Plasmid#104227PurposeBacterial expression of WW domain #1 from YAP1DepositorInsertYAP1 WW domain #1 (YAP1 Human)
TagsGSTExpressionBacterialMutationcodon optimized for expression in bacteriaPromotertacAvailable SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJS101
Plasmid#118280PurposeExpresses GFPmut2 with low cell-to-cell variation on a low-copy plasmid and tetracycline inductionDepositorInsertGFPmut2
ExpressionBacterialPromoterpLtetO-1Available SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
Tg(mpeg1:EGFP-Mmu.Rpl10a)
Plasmid#128840PurposeRNA isolation from machrophages via TRAPDepositorInsertEGFP-L10a
UseZebrafish expressionAvailable SinceFeb. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
SOX17-tdTomato-EhB
Plasmid#210467PurposeDonor plasmid for knock-in tdTomato into the human SOX17 locusDepositorInsertSOX17 homologous recombination arms with a NLS-tdTomato and EF1alpha-drived hygromycin-NLS-mTagBFP2 selection cassette (SOX17 Human)
UseCRISPRAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Jarid1c-IRES-GFP
Plasmid#166009PurposeRetroviral biscistronic expression of Jarid1c and eGFPDepositorAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
Ube2w
Plasmid#31432DepositorAvailable SinceOct. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTA-attB
Plasmid#18937DepositorInsertphiC31 attB
ExpressionBacterialAvailable SinceOct. 17, 2008AvailabilityAcademic Institutions and Nonprofits only