We narrowed to 22,807 results for: crispr
-
Plasmid#76560Purpose3rd generation lentiviral gRNA plasmid targeting human ADCK4DepositorInsertADCK4
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMS74 (synthetic guide::∆HYGR::unc-54 3' UTR^SEC)
Plasmid#154838PurposeInsertion of split hygromycin landing pad into ChrII:8420157 site C. elegans strains via CRISPR with SEC selectionDepositorInsertsynthetic guide::∆HYGR::unc-54 3' UTR
UseCRISPR and Cre/LoxTagsExpressionWormMutation∆HYGR is promoterless and encodes aa 60-341PromoterAvailable sinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-ABE-3'UTR-sgRNA-2xMS2
Plasmid#132554PurposeVector plasmid expressing ABEmax and sgRNA scaffold with MS2 replacing the Tetraloop and loop 2DepositorInsertsABEmax
sgRNA, with Tetraloop and loop 2 replaced by MS2 aptamer
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
PAX6 sgRNA2
Plasmid#68465Purposetargeting PAX6 geneDepositorInsertsgRNA targeting PAX6 (PAX6 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 probasin_mTQ2_FlpO
Plasmid#68357PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and 8, and SMAD4 ex2 and ex 9 are expressed by the U6 promoter.DepositorInserts5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianMutationPromoterU6 and synthetic Probasin ARRx2Available sinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
ADCK3 gRNA (BRDN0001147832)
Plasmid#77321Purpose3rd generation lentiviral gRNA plasmid targeting human ADCK3DepositorInsertADCK3
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ADCK3 gRNA (BRDN0001146491)
Plasmid#77323Purpose3rd generation lentiviral gRNA plasmid targeting human ADCK3DepositorInsertADCK3
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
-
PX458_BCL6_iso1_2
Plasmid#104047PurposeEncodes gRNA for 3' target of human BCL6_iso1 along with Cas9 with 2A GFPDepositorInsertBCL6_iso1 gRNA (BCL6 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_BCL6_iso1_1
Plasmid#104046PurposeEncodes gRNA for 3' target of human BCL6_iso1 along with Cas9 with 2A GFPDepositorInsertBCL6_iso1 gRNA (BCL6 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
ADRBK2 gRNA (BRDN0001487158)
Plasmid#77943Purpose3rd generation lentiviral gRNA plasmid targeting human ADRBK2DepositorInsertADRBK2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_FOXM1_iso1_2
Plasmid#135753PurposeEncodes gRNA for 3' target of human FOXM1_iso1DepositorInsertFOXM1_iso1 gRNA (FOXM1 Human)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceJan. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX458_FOXM1_iso1_1
Plasmid#135752PurposeEncodes gRNA for 3' target of human FOXM1_iso1DepositorInsertFOXM1_iso1 gRNA (FOXM1 Human)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceJan. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pY036_ATP1A1_G5
Plasmid#86618PurposeExpresses the ATP1A1 G5 crRNA in combination with AsCpf1-3xHA to target ATP1A1 intron 4. U6-crRNA(ATP1A1 G5)-CBh-AsCpf1DepositorInsertATP1A1 G5 crRNA + AsCpf1-3xHA
UseCRISPR; Co-selection via hdr using ouabainTags3xHAExpressionMammalianMutationPromoterCBhAvailable sinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYPQ292 (AaCas12b)-D570A-TV
Plasmid#136380PurposeCRISPRa Gateway entry clone for catalytically dead AaCas12b (D570A) fused with TV activation systemDepositorInsertAaCas12b (D570A)-TV
UseCRISPRTagsExpressionPlantMutationD570APromoterAvailable sinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralTagsExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish-gRNA-0001
Plasmid#42241PurposegRNA targeted to zebrafish gene apoeaDepositorInsertgRNA-apoea (apoea Zebrafish)
UseCRISPR; Zebrafish expressionTagsExpressionMutationPromoterT7Available sinceJan. 31, 2013AvailabilityAcademic Institutions and Nonprofits only