We narrowed to 24,925 results for: crispr
-
Plasmid#121917PurposeEncodes sgRNA targeting exon 4 of TP53DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTP53 (TP53 Human)
UseCRISPRPromoterU6Available sinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PB-gRNA-Puro
Plasmid#121121PurposeExpression of a gRNA together with a Puromycin resistanceDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA
UseCRISPRExpressionMammalianAvailable sinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV:ITR-EF1aCore-SaCas9-dual(U6-sgRNA(backbone))-ITR
Plasmid#207878PurposeAAV vector encoding EF1a core promoter-driven SaCas9 and two sgRNA cloning sites w/ the engineered Sa Guide scaffold variant (BbsI and PaqCI for sgRNA cloning).DepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable sinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGGDestTol2LC-4sgRNA
Plasmid#64242Purposedestination vector for four U6x:sgRNA cassettesDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 5, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
7a sgRNA for EJ7-GFP and 4-μHOM reporters
Plasmid#113620PurposesgRNA/CAS9 expression plasmid to induce the 5’ double-strand break in both the EJ7-GFP and 4-μHOM reportersDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsert7a sgRNA
UseCRISPRExpressionMammalianAvailable sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCryptDel4.8
Plasmid#141293PurposePlasmid for curing pMUT2 in one step based on pFREE. Contains RelB antitoxin, as well as gRNA targetting pMUT2 plasmid as well as pCryptDel4.8 itself.DepositorInsertsRelB
gRNA targetting pMUT2
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterNative promoter from pMUT2 relB/relE operon and P…Available sinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
6xHis-MBP-BrCas12b-RFND
Plasmid#195339PurposeExpresses Engineered BrCas12b in BacteriaDepositorInsertBrCas12b
UseCRISPR and Synthetic BiologyTags6xHis and 6xHis, MBP, TEV cleavage siteExpressionBacterialMutationR160E, F208W, N524V, D868VPromoterT7Available sinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMOD_A0101
Plasmid#90998PurposeModule A, Promoter: 35S, Gene: AtCas9, Terminator: HSPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAtCas9
UseCRISPRPromoter35SAvailable sinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRG2
Plasmid#104174PurposesgRNA expressionDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable sinceDec. 19, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGTag-TagRFP-CAAX-SV40
Plasmid#117809PurposeDonor for precise CRISPR directed genomic integration using the GeneWeld methodDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTagRFP
UseSynthetic BiologyTagsCAAXAvailable sinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgTP53_3
Plasmid#78164PurposesgTP53DepositorAvailable sinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJW1310
Plasmid#61253PurposeTemplate for cloning U6 promoter to generate new PU6::sgRNAs by PCR-fusionDepositorInsertU6 promoter
UseCRISPR; Cloning templateAvailable sinceDec. 18, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDD317 (Pmyo-2::GFP + SEC)
Plasmid#73344PurposeSEC vector carry Pmyo-2::GFP and ccdB sites for cloning homology armsDepositorInsertPmyo-2::GFP + SEC
UseCRISPR and Cre/LoxTagsGFPExpressionWormPromotermyo-2Available sinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA(MS2)_EF1a-MS2-P65-HSF1
Plasmid#92120PurposeExpression plasmid for both MS2-P65-HSF1 activator helper complex and sgRNA with two MS2 loops at tetraloop and stemloop 2 contains BsaI sites for insertion of spacer sequences.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMS2-P65-HSF1 (HSF1 Synthetic, Human)
UseCRISPRExpressionMammalianPromoterEF1aAvailable sinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AICSDP-60: SOX2-mEGFP
Plasmid#124606PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human SOX2DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSOX2 Homology Arms with linker-mEGFP (SOX2 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceMay 13, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMK346 (Hygro-P2A-mAID-mCherry)
Plasmid#121180PurposeN-terminal taggingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHygro-P2A-mAID-mCherry
UseCRISPRAvailable sinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDY1330 STITCHR pCMV-nCas9-XTEN-v170_R2Tocc
Plasmid#234826PurposeSTITCHR R2Tocc editorDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertnCas9h840a-xten-R2Tocc
UseCRISPRAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA Ef1alpha Puro-T2A-GFP
Plasmid#111596PurposesgRNA Ef1alpha Puro-T2A-GFPDepositorInsertmU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable sinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEN243-KH217
Plasmid#224550PurposeCas9-2A-puro and sgRNA targeting the STOP codon mouse Car2DepositorInsertCas9 and sgRNA targeting the STOP codon of mouse CAR2 (Car2 Mouse)
UseCRISPRExpressionMammalianAvailable sinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available sinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only