We narrowed to 10,056 results for: transfer
-
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_ACTB CRISPIE
Plasmid#172853PurposeActb sgRNA & DRS-2 sgRNA expression under U6. CRISPIE donor mEGFP phase (0-0), excised by DRS-1 or DRS-2 (with SpCas9). Also expresses mRuby3 under the CBA promotor. See Zhong et al, eLife 2021.DepositorInsertsActb intron 1 sgRNA
DRS-2 sgRNA
CRISPIE designer exon (phase 0-0) encoding mEGFP
mRuby3
UseAAV and CRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEMS2049
Plasmid#79657PurposessAAV genome with Ple260 (PAX6 MiniPromoter) driving an emerald GFP (EmGFP) reporter. Contains WPREDepositorInsertssAAV Ple260-EmGFP WPRE
UseAAVPromoterPAX6 Retinal EnhancerAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
RCAS-sgATG7
Plasmid#75228PurposeAn adaption on the RCAS/tv-a somatic cell gene transfer system, for use in combination with an existing Cas9 background in the cell/mouse of interest. Depositors: Jane Fraser/Noor GammohDepositorAvailable SinceJune 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
Plasmid#165492PurposeNeuronal expression of PACmn with dark Venus, a photoactivatable adenylyl cyclase derived from bPAC, membrane-anchored, no/reduced dark activityDepositorInsert2xLyn-ERex-Venus(Y145W)-bPAC(F198Y)
UseAAVTagsdarkVenusExpressionMammalianPromoterhSyn1Available SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEMS2045
Plasmid#79653PurposessAAV genome with Ple256 (PAX6 MiniPromoter) driving an emerald GFP (EmGFP) reporter. Contains WPREDepositorInsertssAAV Ple256-EmGFP WPRE
UseAAVPromoterPAX6 enhancerAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEMS2048
Plasmid#79656PurposessAAV genome with Ple259 (PAX6 MiniPromoter) driving an emerald GFP (EmGFP) reporter. Contains WPREDepositorInsertssAAV Ple259-EmGFP WPRE
UseAAVPromoterPAX6 MiniPromoterAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-CCR5 gRNA (SpyCas9 scaffold)
Plasmid#113041PurposeAAV vector; encodes GFP as well as a U6-driven CCR5-targeting gRNA (SpyCas9 scaffold)DepositorInsertgRNA CCR5 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
DNMT3ACD-CRY2-EGFP
Plasmid#82556PurposeEncodes DMNT3 under LITE2.0 systemDepositorUseAAVTags2A, NLS(alpha-imp), and NLS-VP64ExpressionMammalianMutationCRY2PHR (N-terminal photolyase homology region do…PromoterEF-1alphaAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1534 pscAAV mU6 shRNA(PKCd) CMV-IE Nuc-EYFP
Plasmid#135562PurposeAn AAV vector expressing shRNA vs rat PKCd and a nuclear EYFP reporterDepositorInsertsshRNA (mouse PKCd)
Nuc-EYFP
UseAAV and RNAiTags3xNLSExpressionMammalianPromoterCMV-IE and mU6Available SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV8-hSyn-flex-miR30-eGFP-shNts
Plasmid#132717PurposeEncodes Cre-dependent short hairpin RNA (shRNA) that targets the 3’-untranslated region of the rat Nts gene which encodes neurotensinDepositorAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
TET1CD-CRY2-EGFP
Plasmid#82555PurposeEncodes TET1 under LITE2.0 systemDepositorUseAAVTags2A, NLS(alpha-imp), and NLS-VP64ExpressionMammalianMutationCRY2PHR (N-terminal photolyase homology region do…PromoterEF-1alphaAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV Intein-C-SpyCas9, CMV-AcrIIA4-scaffold (2xBsmBI sites)
Plasmid#120294PurposeAAV Vector for expression of C-terminal SpyCas9 fragemnt with split-intein and a CMV-driven AcrIIA4 (no miR binding sites)DepositorInsertC-terminal fragment of SpyCas9
UseAAV and CRISPRTagssplit-inteinExpressionMammalianAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1α1.1-SomArchon-GFP
Plasmid#153531PurposeAAV-mediated expression of SomArchon-GFP under the EF1α1.1 promoter.DepositorInsertSomArchon-GFP
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterEF1α1.1Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEMS2043
Plasmid#79651PurposessAAV genome with Ple254 (PAX6 MiniPromoter) driving an emerald GFP (EmGFP) reporter. Contains WPREDepositorInsertssAAV Ple254-EmGFP WPRE
UseAAVPromoterPAX6 Retinal EnhancerAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEMS1984
Plasmid#49115PurposeAAV plasmid with PITX3 (Ple253) promoter driving expression of iCre. Contains WPRE.DepositorInsertssAAV-Ple253-iCre-WPRE
UseAAVExpressionMammalianPromoterPITX3Available SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJEP320-pAAV-U6SaCas9gRNA(CREB3)_EFS-GFP-KASH-pA
Plasmid#113697PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting CREB, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-EMX1 gRNA (SpyCas9 scaffold)
Plasmid#113040PurposeAAV vector; encodes GFP as well as a U6-driven EMX1-targeting gRNA (SpyCas9 scaffold)DepositorInsertgRNA EMX1 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAVscCBPITuDlet-7Gpluc
Plasmid#35652DepositorInsertTuD let-7
UseAAVPromoterU6Available SinceApril 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-CFTR gRNA (SpyCas9 scaffold)
Plasmid#113042PurposeAAV vector; encodes GFP as well as a U6-driven CFTR-targeting gRNA (SpyCas9 scaffold)DepositorInsertCFTR gRNA (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only