We narrowed to 1,090 results for: cas12a
-
Plasmid#236040PurposeThe plasmid pQdCas12a.sggfp(B) expresses the dCas12a endonuclease and the sgRNA (design B) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(C)
Plasmid#236043PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(C) expresses the dCas12a endonuclease and the sgRNA (design C) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (C) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-empty
Plasmid#236037PurposeThe plasmid pQdCas12a.luxR(mut)-empty expresses the dCas12a endonuclease. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI, dcas12a, and lacZ-alpha (fragment).
UseCRISPRPromoterquorum sensing promoterAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_Nlux_(-HH)crRNA NR1
Plasmid#176250PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1 without the hammerhead ribozymDepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux_crRNA NR1
Plasmid#176244PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKL038 Lenti U6 dCas12a gRNA Puro mCherry
Plasmid#195546PurposedCas12a gRNA expression backboneDepositorInsertLenti U6- empty cassette_Direct repeat_puro_mcherry
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hMb3Cas12a-NLS(nucleoplasmin)-3xHA (RTW2500)
Plasmid#115142PurposeCAG promoter expression plasmid for human codon optimized Mb3Cas12a nuclease with C-terminal NLS and HA tagDepositorInserthuman codon optimized Mb3Cas12a
TagsNLS(nucleoplasmin) and 3xHAExpressionMammalianAvailable sinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
SM468_EF1A-dHyperLbCas12a-T2A-EGFP
Plasmid#244220PurposeMammalian expression of dHyperLbCas12a with EGFP selectable markerDepositorInsertdHyperLbCas12a
UseCRISPR and LentiviralExpressionMammalianMutationdHyperLbCas12a: D156R, D235R, E292R, E350R, and D…Available sinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTE3179
Plasmid#107528PurposeExpresses Mb crRNA and mCherry in mammalian cells.DepositorInsertsMb crRNA
mCherry
ExpressionMammalianPromoterCBh and human U6Available sinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac-hyperdLbCas12a
Plasmid#247777PurposePiggyBac backbone with the hyperdLbCas12a expression cassette (from pSLQ11438).DepositorInsertABE8e-hyperLbCas12a-mCherry-p2a-puro
UseCRISPR and Synthetic BiologyTagsmCherry-p2a-puroExpressionMammalianPromoterEF1aAvailable sinceJuly 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-NF-L2-dMb2Cas12a
Plasmid#177684PurposeGateway entry clone (attL1 & attR5) for dimeric FokI-dMb2Cas12a genome editingDepositorInsertFokI-dMb2Cas12a
UseCRISPR; Gateway compatible foki-dmb2cas12a entry …TagsNLSExpressionPlantAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_crRNA NR2
Plasmid#176248PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence without Nlux tag and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_crRNA NR1
Plasmid#176247PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence without Nlux tag and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1DepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_crRNA NR3
Plasmid#176249PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence without Nlux tag and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 3DepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available sinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
SM265_EF1A-dHyperLbCas12a-KRAB-T2A-EGFP
Plasmid#244204PurposeMammalian expression of dHyperLbCas12a-KRAB with EGFP selectable markerDepositorInsertdHyperLbCas12a-KRAB
UseCRISPR and LentiviralExpressionMammalianMutationdHyperLbCas12a: D156R, D235R, E292R, E350R, and D…Available sinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
SM470_EF1A-dEnAsCas12a-T2A-EGFP
Plasmid#244222PurposeMammalian expression of dEnAsCas12a with EGFP selectable markerDepositorInsertdEnAsCas12a
UseCRISPR and LentiviralExpressionMammalianMutationdEnAsCas12a: E174R, S542R, K548R, and D908AAvailable sinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
SM469_EF1A-dHyperLbCas12a-T2A-BlastR
Plasmid#244221PurposeMammalian expression of dHyperLbCas12a with Blasticidin resistance selectable markerDepositorInsertdHyperLbCas12a
UseCRISPR and LentiviralExpressionMammalianMutationdHyperLbCas12a: D156R, D235R, E292R, E350R, and D…Available sinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site3 (RTW549)
Plasmid#160138PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #3DepositorInsertAsCas12a crRNA with spacer #3 (spacer=CTGATGGTCCATGTCTGTTACTC)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAR015 Lenti pEF-dEnAsCas12a-NLS-NFZ-3XHA-T2A-BSD
Plasmid#195544PurposedCas12a effector fusion for manipulating transcriptionDepositorInsertLenti pEF-dEnAsCas12a-NLS-NFZ-3XHA-T2A-BSD
UseCRISPR and LentiviralTags3XHAExpressionMammalianPromoterpEF1aAvailable sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only