We narrowed to 488 results for: mRuby2
-
Plasmid#181860PurposePart of FluoSTEP-RhoA biosensor; co-express with cpPKN-mRuby2-GFP1-10 (Addgene #181859).DepositorAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only
-
Ad:2CMV_A2R2-N25K3
Plasmid#122242PurposeExpresses a dominant negative Kash construct that disrupts LINC complexes in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianPromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Nabi2.244
Plasmid#73756PurposeNabi2.244 is a FRET (Förster Resonance Energy Transfer)-based protein voltage sensor. This probe contains Clover and mRuby2 inserted at different locations in the Ciona voltage sensitive domain.DepositorInsertNabi2.244
ExpressionMammalianAvailable SinceApril 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ECT2_sgRNA
Plasmid#183875PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ECT2 sgRNA for N-terminal tagging of Ect2 in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-CfANLN_sgRNA
Plasmid#183879PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and cfANLN sgRNA for N-terminal tagging of anillin in canine (Canis familiaris) cells.DepositorInsertCanis familiaris ANLN sgRNA spacer
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-H2BC11_sgRNA
Plasmid#183881PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and H2BC11 sgRNA for C-terminal tagging of H2B histones in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-MYH10_sgRNA
Plasmid#183886PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and MYH10 sgRNA for N-terminal tagging of myosin heavy chain 10 in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
MTK0_012
Plasmid#123967PurposeEncodes the hROSA26 BxBI recognition site with Hygromycin resistance and mRuby2 landing pad with GFP dropout destination vector as a type 0 part to be used in the MTK systemDepositorInserthRosa26-BxBI landing pad
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMIA3
Plasmid#109399PurposeExpresses sgRNA cassette (BsmBI cloning site) and EF1-A driven eSpCas9 linked via P2A with mRuby2 and dominant negative mtp53 for enhanced survival of hES after DSBDepositorTypeEmpty backboneUseCRISPRTagsmRuby2 and mtp53dnExpressionMammalianPromoterEF1aAvailable SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
Nabi2.30
Plasmid#73798PurposeNabi2.30 is a FRET (Förster Resonance Energy Transfer)-based protein voltage sensor. This probe contains Clover and mRuby2 inserted at different locations in the Ciona voltage sensitive domain.DepositorInsertNabi2.30
ExpressionMammalianAvailable SinceApril 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nabi2.104
Plasmid#73799PurposeNabi2.104 is a FRET (Förster Resonance Energy Transfer)-based protein voltage sensor. This probe contains Clover and mRuby2 inserted at different locations in the Ciona voltage sensitive domain.DepositorInsertNabi2.104
ExpressionMammalianAvailable SinceApril 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nabi2.125
Plasmid#73800PurposeNabi2.125 is a FRET (Förster Resonance Energy Transfer)-based protein voltage sensor. This probe contains Clover and mRuby2 inserted at different locations in the Ciona voltage sensitive domain.DepositorInsertNabi2.125
ExpressionMammalianAvailable SinceApril 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nabi2.216
Plasmid#73801PurposeNabi2.216 is a FRET (Förster Resonance Energy Transfer)-based protein voltage sensor. This probe contains Clover and mRuby2 inserted at different locations in the Ciona voltage sensitive domain.DepositorInsertNabi2.216
ExpressionMammalianAvailable SinceApril 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nabi2.226
Plasmid#73802PurposeNabi2.226 is a FRET (Förster Resonance Energy Transfer)-based protein voltage sensor. This probe contains Clover and mRuby2 inserted at different locations in the Ciona voltage sensitive domain.DepositorInsertNabi2.226
ExpressionMammalianAvailable SinceApril 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
Nabi2.213
Plasmid#73757PurposeNabi2.213 is a FRET (Förster Resonance Energy Transfer)-based protein voltage sensor. This probe contains Clover and mRuby2 inserted at different locations in the Ciona voltage sensitive domain.DepositorInsertNabi2.213
ExpressionMammalianAvailable SinceApril 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
MTK0_011
Plasmid#123966PurposeEncodes the hROSA26 PhiC31 recognition site with Hygromycin resistance and mRuby2 landing pad with GFP dropout destination vector as a type 0 part to be used in the MTK systemDepositorInserthRosa26-PhiC31 landing pad
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK0_052
Plasmid#123978PurposeEncodes the PhiC31 landing pad on hThal5.10-2-hg18 with hygromycin resistance cassette coexpressed with mRuby2 as a type 0 part to be used in the MTK systemDepositorInsertPhiC31 LP on hThal5.10-2-hg18 (Hygro::mRuby)
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK0_054
Plasmid#123980PurposeEncodes the PhiC31 landing pad on hCLYBL with hygromycin resistance cassette coexpressed with mRuby2 as a type 0 part to be used in the MTK systemDepositorInsertPhiC31 LP on hCLYBL (Hygro::mRuby)
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-postASAP-p2a-ChrimsonR
Plasmid#178794PurposeExpresses voltage sensor targeted to dendrites and spines along with ChrimsonRDepositorInsertFingR.PSD95, ASAP2f and ChrimsonR
TagsmRuby2ExpressionMammalianMutationmutations in amino acids L146G, S147T N149R, S150…PromoterCAGAvailable SinceDec. 10, 2021AvailabilityAcademic Institutions and Nonprofits only